EMAIL THIS PAGE TO A FRIEND

ANO1

anoctamin 1, calcium activated chloride channel

96 Gene Product Result for
Synonyms: DOG1 ORAOV2 TAOS2 TMEM16A
UniProtKB ID: Q5XXA6, A8KAM3, Q8IYY8, Q8N7V3
Gene ID:
Mouse(101772) anoctamin 1, calcium activated chloride channel
Rat(309135) anoctamin 1, calcium activated chloride channel
Zebrafish(407698) anoctamin 1, calcium activated chloride channel
cow(532126) anoctamin 1, calcium activated chloride channel
Horse(100061836) anoctamin 1, calcium activated chloride channel
domestic cat(101087608) anoctamin 1, calcium activated chloride channel
dog(611698) anoctamin 1, calcium activated chloride channel
chicken(423144) anoctamin 1, calcium activated chloride channel
domestic guinea pig(100529098) anoctamin 1, calcium activated chloride channel
naked mole-rat(101710339) anoctamin 1, calcium activated chloride channel
sheep(101116524) anoctamin 1, calcium activated chloride channel
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140771 MISSION® esiRNA esiRNA human ANO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018043 Rosetta Predictions human pricing
NM_001107564 Rosetta Predictions rat pricing
NM_178642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231162 predicted 2495
2 SASI_Hs01_00231163 predicted 2655
3 SASI_Hs01_00231164 predicted 1533
4 SASI_Hs01_00231165 predicted 1530
5 SASI_Hs01_00231166 predicted 1352
6 SASI_Hs01_00231167 predicted 2697
7 SASI_Hs01_00231169 predicted 1439
8 SASI_Hs01_00231170 predicted 2682
9 SASI_Hs02_00351163 predicted 1039
10 SASI_Hs02_00351164 predicted 760
11 SASI_Hs01_00231161 predicted 1481
12 SASI_Hs01_00231168 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230075 predicted 1670
2 SASI_Rn02_00230076 predicted 1317
3 SASI_Rn02_00230077 predicted 378
4 SASI_Rn02_00230078 predicted 2057
5 SASI_Rn02_00230079 predicted 1750
6 SASI_Rn02_00230080 predicted 1803
7 SASI_Rn02_00230081 predicted 1815
8 SASI_Rn02_00230082 predicted 800
9 SASI_Rn02_00230083 predicted 1234
10 SASI_Rn02_00230084 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349041 predicted 1070
2 SASI_Mm02_00349042 predicted 299
3 SASI_Mm02_00349043 predicted 938
4 SASI_Mm02_00349044 predicted 1515
5 SASI_Mm02_00349045 predicted 1672
6 SASI_Mm02_00349046 predicted 2040
7 SASI_Mm02_00349047 predicted 1601
8 SASI_Mm02_00349048 predicted 309
9 SASI_Mm02_00349049 predicted 2203
10 SASI_Mm02_00349050 predicted 2518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018043
ANO1 MISSION shRNA Bacterial Glycerol Stock
anoctamin 1, calcium activated chloride channel
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-439s21c1
Sequence:CCGGCTGATGCCGAGTGCAAGTATGCTCGAGCATACTTGCACTCGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-2881s21c1
Sequence:CCGGTGCAGATCTGCAGGTATAAAGCTCGAGCTTTATACCTGCAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018043.5-3510s21c1
Sequence:CCGGTGGCTGGTAATACGGCAATAACTCGAGTTATTGCCGTATTACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-943s1c1
Sequence:CCGGCGTCGAGTTCAACGACAGAAACTCGAGTTTCTGTCGTTGAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2335s1c1
Sequence:CCGGCATCGGAATCTGGTACAATATCTCGAGATATTGTACCAGATTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2005s1c1
Sequence:CCGGGCTGATCCAGAACAACCTGTTCTCGAGAACAGGTTGTTCTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1018s1c1
Sequence:CCGGCGACCTGGTCAGGAAGTATTTCTCGAGAAATACTTCCTGACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1537s1c1
Sequence:CCGGCCTCACTAACTTGGTCTCCATCTCGAGATGGAGACCAAGTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018043
ANO1 MISSION shRNA shRNA Plasmid DNA
anoctamin 1, calcium activated chloride channel
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-439s21c1
Sequence:CCGGCTGATGCCGAGTGCAAGTATGCTCGAGCATACTTGCACTCGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-2881s21c1
Sequence:CCGGTGCAGATCTGCAGGTATAAAGCTCGAGCTTTATACCTGCAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018043.5-3510s21c1
Sequence:CCGGTGGCTGGTAATACGGCAATAACTCGAGTTATTGCCGTATTACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-943s1c1
Sequence:CCGGCGTCGAGTTCAACGACAGAAACTCGAGTTTCTGTCGTTGAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2335s1c1
Sequence:CCGGCATCGGAATCTGGTACAATATCTCGAGATATTGTACCAGATTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2005s1c1
Sequence:CCGGGCTGATCCAGAACAACCTGTTCTCGAGAACAGGTTGTTCTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1018s1c1
Sequence:CCGGCGACCTGGTCAGGAAGTATTTCTCGAGAAATACTTCCTGACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1537s1c1
Sequence:CCGGCCTCACTAACTTGGTCTCCATCTCGAGATGGAGACCAAGTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018043
ANO1 MISSION shRNA Lentiviral Transduction Particles
anoctamin 1, calcium activated chloride channel
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-439s21c1
Sequence:CCGGCTGATGCCGAGTGCAAGTATGCTCGAGCATACTTGCACTCGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018043.5-2881s21c1
Sequence:CCGGTGCAGATCTGCAGGTATAAAGCTCGAGCTTTATACCTGCAGATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018043.5-3510s21c1
Sequence:CCGGTGGCTGGTAATACGGCAATAACTCGAGTTATTGCCGTATTACCAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-943s1c1
Sequence:CCGGCGTCGAGTTCAACGACAGAAACTCGAGTTTCTGTCGTTGAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2335s1c1
Sequence:CCGGCATCGGAATCTGGTACAATATCTCGAGATATTGTACCAGATTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-2005s1c1
Sequence:CCGGGCTGATCCAGAACAACCTGTTCTCGAGAACAGGTTGTTCTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1018s1c1
Sequence:CCGGCGACCTGGTCAGGAAGTATTTCTCGAGAAATACTTCCTGACCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018043.4-1537s1c1
Sequence:CCGGCCTCACTAACTTGGTCTCCATCTCGAGATGGAGACCAAGTTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178642
VALIDATED
ANO1 MISSION shRNA Bacterial Glycerol Stock
anoctamin 1, calcium activated chloride channel
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-3982s1c1
Sequence:CCGGCCAAATACTGAGAGGAAATTACTCGAGTAATTTCCTCTCAGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-1747s1c1
Sequence:CCGGCGGAGTTATCATCTATAGAATCTCGAGATTCTATAGATGATAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2924s1c1
Sequence:CCGGGTTCTCATGGTGGAGCTGTTTCTCGAGAAACAGCTCCACCATGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2399s1c1
Sequence:CCGGGCCCTGCTAAACAACATCATTCTCGAGAATGATGTTGTTTAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178642
VALIDATED
ANO1 MISSION shRNA shRNA Plasmid DNA
anoctamin 1, calcium activated chloride channel
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-3982s1c1
Sequence:CCGGCCAAATACTGAGAGGAAATTACTCGAGTAATTTCCTCTCAGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-1747s1c1
Sequence:CCGGCGGAGTTATCATCTATAGAATCTCGAGATTCTATAGATGATAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2924s1c1
Sequence:CCGGGTTCTCATGGTGGAGCTGTTTCTCGAGAAACAGCTCCACCATGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2399s1c1
Sequence:CCGGGCCCTGCTAAACAACATCATTCTCGAGAATGATGTTGTTTAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178642
VALIDATED
ANO1 MISSION shRNA Lentiviral Transduction Particles
anoctamin 1, calcium activated chloride channel
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-3982s1c1
Sequence:CCGGCCAAATACTGAGAGGAAATTACTCGAGTAATTTCCTCTCAGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-1747s1c1
Sequence:CCGGCGGAGTTATCATCTATAGAATCTCGAGATTCTATAGATGATAACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2924s1c1
Sequence:CCGGGTTCTCATGGTGGAGCTGTTTCTCGAGAAACAGCTCCACCATGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178642.3-2399s1c1
Sequence:CCGGGCCCTGCTAAACAACATCATTCTCGAGAATGATGTTGTTTAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks