EMAIL THIS PAGE TO A FRIEND

ANO2

anoctamin 2

56 Gene Product Result for
Synonyms: C12orf3 TMEM16B
UniProtKB ID: Q9NQ90, C4N787, Q9H847
Gene ID:
Human(57101) Summary: ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]
Mouse(243634) anoctamin 2
Rat(683001) anoctamin 2
Zebrafish(566373) anoctamin 2
dog(100687505) anoctamin 2
chicken(428100) anoctamin 2
Horse(100051900) anoctamin 2
cow(512529) anoctamin 2
sheep(101111185) anoctamin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036276 Anti-ANO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB2900798 Anti-ANO2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB3500159 Anti-TMEM16B antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045141 MISSION® esiRNA esiRNA human ANO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020373 Rosetta Predictions human pricing
XM_001066367 Rosetta Predictions rat pricing
XM_001066415 Rosetta Predictions rat pricing
NM_153589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159593 predicted 2142
2 SASI_Hs01_00159594 predicted 606
3 SASI_Hs01_00159596 predicted 267
4 SASI_Hs01_00159597 predicted 1719
5 SASI_Hs01_00159598 predicted 2495
6 SASI_Hs01_00159599 predicted 2396
7 SASI_Hs01_00159600 predicted 682
8 SASI_Hs01_00159601 predicted 1296
9 SASI_Hs01_00159602 predicted 2692
10 SASI_Hs02_00353332 predicted 974
11 SASI_Hs01_00159595 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317253 predicted 877
2 SASI_Rn02_00317254 predicted 2010
3 SASI_Rn02_00317255 predicted 1949
4 SASI_Rn02_00317256 predicted 640
5 SASI_Rn02_00317257 predicted 2335
6 SASI_Rn02_00317258 predicted 2595
7 SASI_Rn02_00317259 predicted 1897
8 SASI_Rn02_00317260 predicted 202
9 SASI_Rn02_00317261 predicted 849
10 SASI_Rn02_00317262 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317381 predicted 872
2 SASI_Rn02_00317382 predicted 2052
3 SASI_Rn02_00317383 predicted 1984
4 SASI_Rn02_00317384 predicted 635
5 SASI_Rn02_00317385 predicted 2368
6 SASI_Rn02_00317386 predicted 2631
7 SASI_Rn02_00317387 predicted 1926
8 SASI_Rn02_00317388 predicted 203
9 SASI_Rn02_00317389 predicted 848
10 SASI_Rn02_00317390 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175525 predicted 879
2 SASI_Mm01_00175526 predicted 373
3 SASI_Mm01_00175527 predicted 1969
4 SASI_Mm01_00175528 predicted 2415
5 SASI_Mm01_00175529 predicted 2954
6 SASI_Mm01_00175530 predicted 2926
7 SASI_Mm01_00175531 predicted 1040
8 SASI_Mm01_00175532 predicted 770
9 SASI_Mm01_00175533 predicted 2289
10 SASI_Mm01_00175534 predicted 2944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020373
ANO2 MISSION shRNA Bacterial Glycerol Stock
anoctamin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-940s1c1
Sequence:CCGGGCCAACAACACGATGGGTATTCTCGAGAATACCCATCGTGTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-942s1c1
Sequence:CCGGCAACAACACGATGGGTATTAACTCGAGTTAATACCCATCGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-1522s1c1
Sequence:CCGGCCTGAGTATGAAACCAAAGTTCTCGAGAACTTTGGTTTCATACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-687s1c1
Sequence:CCGGCAAGAAAGAGATGTACGAGATCTCGAGATCTCGTACATCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2398s1c1
Sequence:CCGGCTCGATGCAAAGAAGTTTGTTCTCGAGAACAAACTTCTTTGCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020373.1-3258s1c1
Sequence:CCGGGCTACATCTCAGAAACTTCAACTCGAGTTGAAGTTTCTGAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2028s1c1
Sequence:CCGGCGTCTATGTATTCGATGGTTACTCGAGTAACCATCGAATACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-1656s1c1
Sequence:CCGGCCCAGGTTACCTGATGAACTTCTCGAGAAGTTCATCAGGTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-273s1c1
Sequence:CCGGCAACAACTATCTGGATGCCAACTCGAGTTGGCATCCAGATAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-2680s1c1
Sequence:CCGGGAGGTTCAGTTCTGCAGGTTTCTCGAGAAACCTGCAGAACTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020373
ANO2 MISSION shRNA shRNA Plasmid DNA
anoctamin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-940s1c1
Sequence:CCGGGCCAACAACACGATGGGTATTCTCGAGAATACCCATCGTGTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-942s1c1
Sequence:CCGGCAACAACACGATGGGTATTAACTCGAGTTAATACCCATCGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-1522s1c1
Sequence:CCGGCCTGAGTATGAAACCAAAGTTCTCGAGAACTTTGGTTTCATACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-687s1c1
Sequence:CCGGCAAGAAAGAGATGTACGAGATCTCGAGATCTCGTACATCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2398s1c1
Sequence:CCGGCTCGATGCAAAGAAGTTTGTTCTCGAGAACAAACTTCTTTGCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020373.1-3258s1c1
Sequence:CCGGGCTACATCTCAGAAACTTCAACTCGAGTTGAAGTTTCTGAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2028s1c1
Sequence:CCGGCGTCTATGTATTCGATGGTTACTCGAGTAACCATCGAATACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-1656s1c1
Sequence:CCGGCCCAGGTTACCTGATGAACTTCTCGAGAAGTTCATCAGGTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-273s1c1
Sequence:CCGGCAACAACTATCTGGATGCCAACTCGAGTTGGCATCCAGATAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-2680s1c1
Sequence:CCGGGAGGTTCAGTTCTGCAGGTTTCTCGAGAAACCTGCAGAACTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020373
ANO2 MISSION shRNA Lentiviral Transduction Particles
anoctamin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-940s1c1
Sequence:CCGGGCCAACAACACGATGGGTATTCTCGAGAATACCCATCGTGTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-942s1c1
Sequence:CCGGCAACAACACGATGGGTATTAACTCGAGTTAATACCCATCGTGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-1522s1c1
Sequence:CCGGCCTGAGTATGAAACCAAAGTTCTCGAGAACTTTGGTTTCATACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-687s1c1
Sequence:CCGGCAAGAAAGAGATGTACGAGATCTCGAGATCTCGTACATCTCTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2398s1c1
Sequence:CCGGCTCGATGCAAAGAAGTTTGTTCTCGAGAACAAACTTCTTTGCATCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020373.1-3258s1c1
Sequence:CCGGGCTACATCTCAGAAACTTCAACTCGAGTTGAAGTTTCTGAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020373.1-2028s1c1
Sequence:CCGGCGTCTATGTATTCGATGGTTACTCGAGTAACCATCGAATACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-1656s1c1
Sequence:CCGGCCCAGGTTACCTGATGAACTTCTCGAGAAGTTCATCAGGTAACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-273s1c1
Sequence:CCGGCAACAACTATCTGGATGCCAACTCGAGTTGGCATCCAGATAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020373.1-2680s1c1
Sequence:CCGGGAGGTTCAGTTCTGCAGGTTTCTCGAGAAACCTGCAGAACTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153589
ANO2 MISSION shRNA Bacterial Glycerol Stock
anoctamin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1511s1c1
Sequence:CCGGGCCTCCATCTTGTTTATGATTCTCGAGAATCATAAACAAGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1190s1c1
Sequence:CCGGGCCAGTCATCTGTTTGACAATCTCGAGATTGTCAAACAGATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-786s1c1
Sequence:CCGGCGATGGGTATTAACTCTCTAACTCGAGTTAGAGAGTTAATACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1993s1c1
Sequence:CCGGCCCGAAGCTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153589.1-3207s1c1
Sequence:CCGGCCATCATCTTAGGTGAAAGAACTCGAGTTCTTTCACCTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153589
ANO2 MISSION shRNA shRNA Plasmid DNA
anoctamin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1511s1c1
Sequence:CCGGGCCTCCATCTTGTTTATGATTCTCGAGAATCATAAACAAGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1190s1c1
Sequence:CCGGGCCAGTCATCTGTTTGACAATCTCGAGATTGTCAAACAGATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-786s1c1
Sequence:CCGGCGATGGGTATTAACTCTCTAACTCGAGTTAGAGAGTTAATACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1993s1c1
Sequence:CCGGCCCGAAGCTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153589.1-3207s1c1
Sequence:CCGGCCATCATCTTAGGTGAAAGAACTCGAGTTCTTTCACCTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153589
ANO2 MISSION shRNA Lentiviral Transduction Particles
anoctamin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1511s1c1
Sequence:CCGGGCCTCCATCTTGTTTATGATTCTCGAGAATCATAAACAAGATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1190s1c1
Sequence:CCGGGCCAGTCATCTGTTTGACAATCTCGAGATTGTCAAACAGATGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-786s1c1
Sequence:CCGGCGATGGGTATTAACTCTCTAACTCGAGTTAGAGAGTTAATACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153589.1-1993s1c1
Sequence:CCGGCCCGAAGCTAAAGAAACTCTTCTCGAGAAGAGTTTCTTTAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153589.1-3207s1c1
Sequence:CCGGCCATCATCTTAGGTGAAAGAACTCGAGTTCTTTCACCTAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks