EMAIL THIS PAGE TO A FRIEND

ANO3

anoctamin 3

155 Gene Product Result for
Synonyms: C11orf25 DYT23 DYT24 TMEM16C
UniProtKB ID: Q9BYT9
Gene ID:
Mouse(228432) anoctamin 3
Rat(311287) anoctamin 3
sheep(101114464) anoctamin 3
Zebrafish(553392) anoctamin 3
cow(100139986) anoctamin 3
Horse(100072243) anoctamin 3
dog(476892) anoctamin 3
chicken(422968) anoctamin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031418 Rosetta Predictions human pricing
XM_001080134 Rosetta Predictions rat pricing
XM_230381 Rosetta Predictions rat pricing
NM_001081556 Rosetta Predictions mouse pricing
NM_001128103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227429 predicted 1432
2 SASI_Hs01_00227430 predicted 1357
3 SASI_Hs01_00227432 predicted 1498
4 SASI_Hs01_00227433 predicted 625
5 SASI_Hs02_00358802 predicted 1284
6 SASI_Hs01_00227434 predicted 2600
7 SASI_Hs01_00227435 predicted 1766
8 SASI_Hs01_00227436 predicted 2376
9 SASI_Hs02_00358803 predicted 3083
10 SASI_Hs02_00358804 predicted 2441
11 SASI_Hs01_00227431 predicted 2585
12 SASI_Hs01_00227437 predicted 1991
13 SASI_Hs01_00227438 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366765 predicted 277
2 SASI_Rn02_00366766 predicted 2640
3 SASI_Rn02_00366767 predicted 1570
4 SASI_Rn02_00366768 predicted 2878
5 SASI_Rn02_00366769 predicted 1524
6 SASI_Rn02_00366770 predicted 392
7 SASI_Rn02_00366771 predicted 351
8 SASI_Rn02_00366772 predicted 1384
9 SASI_Rn02_00366773 predicted 2532
10 SASI_Rn02_00366774 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386194 predicted 272
2 SASI_Rn02_00386195 predicted 2643
3 SASI_Rn02_00386196 predicted 1567
4 SASI_Rn02_00386197 predicted 2876
5 SASI_Rn02_00386198 predicted 1523
6 SASI_Rn02_00386199 predicted 351
7 SASI_Rn02_00386200 predicted 1386
8 SASI_Rn02_00386201 predicted 2535
9 SASI_Rn02_00386202 predicted 944
10 SASI_Rn02_00386203 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298670 predicted 461
2 SASI_Mm02_00298671 predicted 563
3 SASI_Mm02_00298672 predicted 1127
4 SASI_Mm02_00298673 predicted 1126
5 SASI_Mm02_00298674 predicted 1449
6 SASI_Mm02_00298675 predicted 1306
7 SASI_Mm02_00298676 predicted 1615
8 SASI_Mm02_00298677 predicted 1740
9 SASI_Mm02_00298678 predicted 592
10 SASI_Mm02_00298679 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310528 predicted 326
2 SASI_Mm02_00310529 predicted 422
3 SASI_Mm02_00310530 predicted 992
4 SASI_Mm02_00310531 predicted 986
5 SASI_Mm02_00310532 predicted 1311
6 SASI_Mm02_00310533 predicted 1162
7 SASI_Mm02_00310534 predicted 1473
8 SASI_Mm02_00310535 predicted 1602
9 SASI_Mm02_00310536 predicted 449
10 SASI_Mm02_00310537 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031418
ANO3 MISSION shRNA Bacterial Glycerol Stock
anoctamin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1190s1c1
Sequence:CCGGCGGATGAATCAGAACACGCTACTCGAGTAGCGTGTTCTGATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031418.1-3264s1c1
Sequence:CCGGCCGAGCAACTGACATAGGTATCTCGAGATACCTATGTCAGTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1521s1c1
Sequence:CCGGGCTGAATATCAGGATGCCCTTCTCGAGAAGGGCATCCTGATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1315s1c1
Sequence:CCGGCCTCTGTTCAAAGATGGCAAACTCGAGTTTGCCATCTTTGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-2717s1c1
Sequence:CCGGCCAATTTAGAATATCCTCGAACTCGAGTTCGAGGATATTCTAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1924s1c1
Sequence:CCGGCCTCAGAATAACAGACATCTACTCGAGTAGATGTCTGTTATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-507s21c1
Sequence:CCGGATGACCGATCTCGTCTCATTACTCGAGTAATGAGACGAGATCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-1533s21c1
Sequence:CCGGTGACATATTTGTTCGATAATGCTCGAGCATTATCGAACAAATATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031418
ANO3 MISSION shRNA shRNA Plasmid DNA
anoctamin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1190s1c1
Sequence:CCGGCGGATGAATCAGAACACGCTACTCGAGTAGCGTGTTCTGATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031418.1-3264s1c1
Sequence:CCGGCCGAGCAACTGACATAGGTATCTCGAGATACCTATGTCAGTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1521s1c1
Sequence:CCGGGCTGAATATCAGGATGCCCTTCTCGAGAAGGGCATCCTGATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1315s1c1
Sequence:CCGGCCTCTGTTCAAAGATGGCAAACTCGAGTTTGCCATCTTTGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-2717s1c1
Sequence:CCGGCCAATTTAGAATATCCTCGAACTCGAGTTCGAGGATATTCTAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1924s1c1
Sequence:CCGGCCTCAGAATAACAGACATCTACTCGAGTAGATGTCTGTTATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-507s21c1
Sequence:CCGGATGACCGATCTCGTCTCATTACTCGAGTAATGAGACGAGATCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-1533s21c1
Sequence:CCGGTGACATATTTGTTCGATAATGCTCGAGCATTATCGAACAAATATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031418
ANO3 MISSION shRNA Lentiviral Transduction Particles
anoctamin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1190s1c1
Sequence:CCGGCGGATGAATCAGAACACGCTACTCGAGTAGCGTGTTCTGATTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031418.1-3264s1c1
Sequence:CCGGCCGAGCAACTGACATAGGTATCTCGAGATACCTATGTCAGTTGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1521s1c1
Sequence:CCGGGCTGAATATCAGGATGCCCTTCTCGAGAAGGGCATCCTGATATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1315s1c1
Sequence:CCGGCCTCTGTTCAAAGATGGCAAACTCGAGTTTGCCATCTTTGAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-2717s1c1
Sequence:CCGGCCAATTTAGAATATCCTCGAACTCGAGTTCGAGGATATTCTAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031418.1-1924s1c1
Sequence:CCGGCCTCAGAATAACAGACATCTACTCGAGTAGATGTCTGTTATTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-507s21c1
Sequence:CCGGATGACCGATCTCGTCTCATTACTCGAGTAATGAGACGAGATCGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031418.2-1533s21c1
Sequence:CCGGTGACATATTTGTTCGATAATGCTCGAGCATTATCGAACAAATATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks