EMAIL THIS PAGE TO A FRIEND

ANO4

anoctamin 4

65 Gene Product Result for
Synonyms: TMEM16D
UniProtKB ID: Q32M45, Q8NAJ0, Q8NB39, Q8NB53
Gene ID:
Mouse(320091) anoctamin 4
Rat(299714) anoctamin 4
chicken(427878) anoctamin 4
cow(518739) anoctamin 4
Horse(100066706) anoctamin 4
dog(612164) anoctamin 4
sheep(101106248) anoctamin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178773 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178773 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178773 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178826 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059641 MISSION® esiRNA esiRNA human ANO4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178826 Rosetta Predictions human pricing
NM_001106778 Rosetta Predictions rat pricing
NM_178773 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138044 predicted 2123
2 SASI_Hs01_00138045 predicted 2609
3 SASI_Hs01_00138046 predicted 1858
4 SASI_Hs02_00369870 predicted 597
5 SASI_Hs02_00369871 predicted 2546
6 SASI_Hs01_00138049 predicted 2918
7 SASI_Hs01_00138050 predicted 2650
8 SASI_Hs01_00138051 predicted 2358
9 SASI_Hs01_00138052 predicted 2633
10 SASI_Hs01_00138053 predicted 1599
11 SASI_Hs01_00138047 predicted 2267
12 SASI_Hs01_00138048 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222308 predicted 2353
2 SASI_Rn02_00222309 predicted 1753
3 SASI_Rn02_00222310 predicted 2013
4 SASI_Rn02_00222311 predicted 2216
5 SASI_Rn02_00222312 predicted 3011
6 SASI_Rn02_00222313 predicted 3232
7 SASI_Rn02_00222314 predicted 2635
8 SASI_Rn02_00222315 predicted 2334
9 SASI_Rn02_00222316 predicted 2451
10 SASI_Rn02_00222317 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178773 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164471 predicted 1483
2 SASI_Mm01_00164472 predicted 1059
3 SASI_Mm01_00164473 predicted 2064
4 SASI_Mm01_00164474 predicted 1637
5 SASI_Mm01_00164475 predicted 2321
6 SASI_Mm02_00349348 predicted 3123
7 SASI_Mm01_00164476 predicted 2745
8 SASI_Mm01_00164477 predicted 1866
9 SASI_Mm01_00164478 predicted 2446
10 SASI_Mm01_00164479 predicted 3301
11 SASI_Mm01_00164480 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178773
ANO4 MISSION shRNA Bacterial Glycerol Stock
anoctamin 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178773.4-3562s21c1
Sequence:CCGGCCGAGCAAGCATGCACGTTATCTCGAGATAACGTGCATGCTTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1464s21c1
Sequence:CCGGGGATCTTGTCAGGCGATATTTCTCGAGAAATATCGCCTGACAAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1048s21c1
Sequence:CCGGTTCATGAGCAGGATCGATAAACTCGAGTTTATCGATCCTGCTCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-2449s21c1
Sequence:CCGGGAACTTGGCTACCCGTTAATTCTCGAGAATTAACGGGTAGCCAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1200s1c1
Sequence:CCGGGCTGTAAACCACCGACATCTACTCGAGTAGATGTCGGTGGTTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-335s1c1
Sequence:CCGGGCAAAGCCATCAGCTGGATATCTCGAGATATCCAGCTGATGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1487s1c1
Sequence:CCGGGCTTTCAGACAGCTGTGTCTACTCGAGTAGACACAGCTGTCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178773
ANO4 MISSION shRNA shRNA Plasmid DNA
anoctamin 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178773.4-3562s21c1
Sequence:CCGGCCGAGCAAGCATGCACGTTATCTCGAGATAACGTGCATGCTTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1464s21c1
Sequence:CCGGGGATCTTGTCAGGCGATATTTCTCGAGAAATATCGCCTGACAAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1048s21c1
Sequence:CCGGTTCATGAGCAGGATCGATAAACTCGAGTTTATCGATCCTGCTCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-2449s21c1
Sequence:CCGGGAACTTGGCTACCCGTTAATTCTCGAGAATTAACGGGTAGCCAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1200s1c1
Sequence:CCGGGCTGTAAACCACCGACATCTACTCGAGTAGATGTCGGTGGTTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-335s1c1
Sequence:CCGGGCAAAGCCATCAGCTGGATATCTCGAGATATCCAGCTGATGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1487s1c1
Sequence:CCGGGCTTTCAGACAGCTGTGTCTACTCGAGTAGACACAGCTGTCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178773
ANO4 MISSION shRNA Lentiviral Transduction Particles
anoctamin 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178773.4-3562s21c1
Sequence:CCGGCCGAGCAAGCATGCACGTTATCTCGAGATAACGTGCATGCTTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1464s21c1
Sequence:CCGGGGATCTTGTCAGGCGATATTTCTCGAGAAATATCGCCTGACAAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-1048s21c1
Sequence:CCGGTTCATGAGCAGGATCGATAAACTCGAGTTTATCGATCCTGCTCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178773.4-2449s21c1
Sequence:CCGGGAACTTGGCTACCCGTTAATTCTCGAGAATTAACGGGTAGCCAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1200s1c1
Sequence:CCGGGCTGTAAACCACCGACATCTACTCGAGTAGATGTCGGTGGTTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-335s1c1
Sequence:CCGGGCAAAGCCATCAGCTGGATATCTCGAGATATCCAGCTGATGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178773.3-1487s1c1
Sequence:CCGGGCTTTCAGACAGCTGTGTCTACTCGAGTAGACACAGCTGTCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178826
ANO4 MISSION shRNA Bacterial Glycerol Stock
anoctamin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-880s1c1
Sequence:CCGGGCTTCGGAGATGGTTACCTAACTCGAGTTAGGTAACCATCTCCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178826.2-3220s1c1
Sequence:CCGGCCACAGTGCATGTTGCAGATACTCGAGTATCTGCAACATGCACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1600s1c1
Sequence:CCGGGCGAGCAGTAATTGCTTATGACTCGAGTCATAAGCAATTACTGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1491s1c1
Sequence:CCGGGCTGTGTATATGCCAAGGTAACTCGAGTTACCTTGGCATATACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-989s1c1
Sequence:CCGGCACTTCATCATACACAACAAACTCGAGTTTGTTGTGTATGATGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178826
ANO4 MISSION shRNA shRNA Plasmid DNA
anoctamin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-880s1c1
Sequence:CCGGGCTTCGGAGATGGTTACCTAACTCGAGTTAGGTAACCATCTCCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178826.2-3220s1c1
Sequence:CCGGCCACAGTGCATGTTGCAGATACTCGAGTATCTGCAACATGCACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1600s1c1
Sequence:CCGGGCGAGCAGTAATTGCTTATGACTCGAGTCATAAGCAATTACTGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1491s1c1
Sequence:CCGGGCTGTGTATATGCCAAGGTAACTCGAGTTACCTTGGCATATACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-989s1c1
Sequence:CCGGCACTTCATCATACACAACAAACTCGAGTTTGTTGTGTATGATGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178826
ANO4 MISSION shRNA Lentiviral Transduction Particles
anoctamin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-880s1c1
Sequence:CCGGGCTTCGGAGATGGTTACCTAACTCGAGTTAGGTAACCATCTCCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178826.2-3220s1c1
Sequence:CCGGCCACAGTGCATGTTGCAGATACTCGAGTATCTGCAACATGCACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1600s1c1
Sequence:CCGGGCGAGCAGTAATTGCTTATGACTCGAGTCATAAGCAATTACTGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-1491s1c1
Sequence:CCGGGCTGTGTATATGCCAAGGTAACTCGAGTTACCTTGGCATATACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178826.2-989s1c1
Sequence:CCGGCACTTCATCATACACAACAAACTCGAGTTTGTTGTGTATGATGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)