EMAIL THIS PAGE TO A FRIEND

ANO5

anoctamin 5

34 Gene Product Result for
Synonyms: GDD1 LGMD2L TMEM16E
UniProtKB ID: Q75V66
Gene ID:
Human(203859) Summary: This gene encodes a member of the anoctamin family of transmembrane proteins. The encoded protein is likely a calcium activated chloride channel. Mutations in this gene have been associated with gnathodiaphyseal dysplasia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
Mouse(233246) anoctamin 5
sheep(101120120) anoctamin 5
chicken(422973) anoctamin 5
cow(100140158) anoctamin 5
Horse(100072055) anoctamin 5
dog(485416) anoctamin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008651 MISSION® esiRNA esiRNA targeting human ANO5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213599 Rosetta Predictions human pricing
NM_177694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158923 predicted 1134
2 SASI_Hs02_00374275 predicted 2151
3 SASI_Hs02_00374276 predicted 1638
4 SASI_Hs01_00158925 predicted 2037
5 SASI_Hs01_00158928 predicted 1714
6 SASI_Hs02_00374277 predicted 1264
7 SASI_Hs01_00158929 predicted 1966
8 SASI_Hs01_00158930 predicted 2473
9 SASI_Hs01_00158931 predicted 380
10 SASI_Hs02_00374278 predicted 1345
11 SASI_Hs01_00158924 predicted 2153
12 SASI_Hs01_00158926 predicted 1853
13 SASI_Hs01_00158927 predicted 1400
14 SASI_Hs01_00158932 predicted 2871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197220 predicted 2619
2 SASI_Mm01_00197221 predicted 2014
3 SASI_Mm01_00197222 predicted 941
4 SASI_Mm01_00197223 predicted 634
5 SASI_Mm01_00197224 predicted 1180
6 SASI_Mm01_00197226 predicted 2961
7 SASI_Mm01_00197227 predicted 1263
8 SASI_Mm01_00197228 predicted 2726
9 SASI_Mm01_00197229 predicted 2150
10 SASI_Mm02_00348036 predicted 2907
11 SASI_Mm01_00197225 predicted 644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213599
VALIDATED
ANO5 MISSION shRNA Bacterial Glycerol Stock
anoctamin 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-1953s1c1
Sequence:CCGGCCTCGAACATACCAGGAGTATCTCGAGATACTCCTGGTATGTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1638s1c1
Sequence:CCGGGCAGTGACTAAGGAGATGGAACTCGAGTTCCATCTCCTTAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-742s1c1
Sequence:CCGGCCTATGCTGAAGTCTTGGGAACTCGAGTTCCCAAGACTTCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213599.2-2356s21c1
Sequence:CCGGTTGGATTTGTTACACTATTTGCTCGAGCAAATAGTGTAACAAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2443s1c1
Sequence:CCGGCCTGGAAACTTACCACTCAATCTCGAGATTGAGTGGTAAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-455s1c1
Sequence:CCGGGCCTGCAAAGCGATTCAATTTCTCGAGAAATTGAATCGCTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2630s1c1
Sequence:CCGGGCCTATGACAGGATATGTGAACTCGAGTTCACATATCCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1611s1c1
Sequence:CCGGGCTATGTGTAAACACAGGAAACTCGAGTTTCCTGTGTTTACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-522s1c1
Sequence:CCGGGATTCTATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213599
VALIDATED
ANO5 MISSION shRNA shRNA Plasmid DNA
anoctamin 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-1953s1c1
Sequence:CCGGCCTCGAACATACCAGGAGTATCTCGAGATACTCCTGGTATGTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1638s1c1
Sequence:CCGGGCAGTGACTAAGGAGATGGAACTCGAGTTCCATCTCCTTAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-742s1c1
Sequence:CCGGCCTATGCTGAAGTCTTGGGAACTCGAGTTCCCAAGACTTCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213599.2-2356s21c1
Sequence:CCGGTTGGATTTGTTACACTATTTGCTCGAGCAAATAGTGTAACAAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2443s1c1
Sequence:CCGGCCTGGAAACTTACCACTCAATCTCGAGATTGAGTGGTAAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-455s1c1
Sequence:CCGGGCCTGCAAAGCGATTCAATTTCTCGAGAAATTGAATCGCTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2630s1c1
Sequence:CCGGGCCTATGACAGGATATGTGAACTCGAGTTCACATATCCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1611s1c1
Sequence:CCGGGCTATGTGTAAACACAGGAAACTCGAGTTTCCTGTGTTTACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-522s1c1
Sequence:CCGGGATTCTATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213599
VALIDATED
ANO5 MISSION shRNA Lentiviral Transduction Particles
anoctamin 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-1953s1c1
Sequence:CCGGCCTCGAACATACCAGGAGTATCTCGAGATACTCCTGGTATGTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1638s1c1
Sequence:CCGGGCAGTGACTAAGGAGATGGAACTCGAGTTCCATCTCCTTAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-742s1c1
Sequence:CCGGCCTATGCTGAAGTCTTGGGAACTCGAGTTCCCAAGACTTCAGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213599.2-2356s21c1
Sequence:CCGGTTGGATTTGTTACACTATTTGCTCGAGCAAATAGTGTAACAAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2443s1c1
Sequence:CCGGCCTGGAAACTTACCACTCAATCTCGAGATTGAGTGGTAAGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213599.1-455s1c1
Sequence:CCGGGCCTGCAAAGCGATTCAATTTCTCGAGAAATTGAATCGCTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213599.1-2630s1c1
Sequence:CCGGGCCTATGACAGGATATGTGAACTCGAGTTCACATATCCTGTCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-1611s1c1
Sequence:CCGGGCTATGTGTAAACACAGGAAACTCGAGTTTCCTGTGTTTACACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_213599.1-522s1c1
Sequence:CCGGGATTCTATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177694
ANO5 MISSION shRNA Bacterial Glycerol Stock
anoctamin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177694.2-2255s1c1
Sequence:CCGGCATGAACAACATCATGGGAATCTCGAGATTCCCATGATGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-723s21c1
Sequence:CCGGTATCCTACTCCTGAGTATTTCCTCGAGGAAATACTCAGGAGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-623s21c1
Sequence:CCGGGGGAATCAAGATGCCTATTAACTCGAGTTAATAGGCATCTTGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177694.5-7602s21c1
Sequence:CCGGTAAGCTTGGTAAGGCTATAAACTCGAGTTTATAGCCTTACCAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-2394s21c1
Sequence:CCGGATCGTTTCTGTTGCAACTAATCTCGAGATTAGTTGCAACAGAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177694
ANO5 MISSION shRNA shRNA Plasmid DNA
anoctamin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177694.2-2255s1c1
Sequence:CCGGCATGAACAACATCATGGGAATCTCGAGATTCCCATGATGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-723s21c1
Sequence:CCGGTATCCTACTCCTGAGTATTTCCTCGAGGAAATACTCAGGAGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-623s21c1
Sequence:CCGGGGGAATCAAGATGCCTATTAACTCGAGTTAATAGGCATCTTGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177694.5-7602s21c1
Sequence:CCGGTAAGCTTGGTAAGGCTATAAACTCGAGTTTATAGCCTTACCAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-2394s21c1
Sequence:CCGGATCGTTTCTGTTGCAACTAATCTCGAGATTAGTTGCAACAGAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177694
ANO5 MISSION shRNA Lentiviral Transduction Particles
anoctamin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177694.2-2255s1c1
Sequence:CCGGCATGAACAACATCATGGGAATCTCGAGATTCCCATGATGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-723s21c1
Sequence:CCGGTATCCTACTCCTGAGTATTTCCTCGAGGAAATACTCAGGAGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-623s21c1
Sequence:CCGGGGGAATCAAGATGCCTATTAACTCGAGTTAATAGGCATCTTGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177694.5-7602s21c1
Sequence:CCGGTAAGCTTGGTAAGGCTATAAACTCGAGTTTATAGCCTTACCAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177694.5-2394s21c1
Sequence:CCGGATCGTTTCTGTTGCAACTAATCTCGAGATTAGTTGCAACAGAAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks