EMAIL THIS PAGE TO A FRIEND

ANO6

anoctamin 6

165 Gene Product Result for
Synonyms: BDPLT7 SCTS TMEM16F
Gene ID:
Human(196527) Summary: This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
Mouse(105722) anoctamin 6
Rat(315272) anoctamin 6
chicken(417802) anoctamin 6
dog(486597) anoctamin 6
cow(521784) anoctamin 6
sheep(101108825) anoctamin 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021451 MISSION® esiRNA esiRNA human ANO6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025356 Rosetta Predictions human pricing
NM_001108108 Rosetta Predictions rat pricing
NM_175344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061140 predicted 1250
2 SASI_Hs01_00061142 predicted 1470
3 SASI_Hs02_00307447 predicted 2847
4 SASI_Hs01_00061143 predicted 1607
5 SASI_Hs01_00061144 predicted 1358
6 SASI_Hs01_00061145 predicted 1213
7 SASI_Hs01_00061146 predicted 893
8 SASI_Hs01_00061147 predicted 1180
9 SASI_Hs02_00307448 predicted 2387
10 SASI_Hs01_00061148 predicted 2872
11 SASI_Hs01_00061141 predicted 2682
12 SASI_Hs01_00061149 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235434 predicted 1354
2 SASI_Rn02_00235435 predicted 725
3 SASI_Rn02_00235436 predicted 1004
4 SASI_Rn02_00235437 predicted 1130
5 SASI_Rn02_00235438 predicted 828
6 SASI_Rn02_00235439 predicted 1109
7 SASI_Rn02_00235440 predicted 489
8 SASI_Rn02_00235441 predicted 576
9 SASI_Rn02_00235442 predicted 582
10 SASI_Rn02_00235443 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346148 predicted 803
2 SASI_Mm01_00100569 predicted 2520
3 SASI_Mm01_00100570 predicted 2156
4 SASI_Mm01_00100571 predicted 348
5 SASI_Mm01_00100572 predicted 1770
6 SASI_Mm01_00100573 predicted 2826
7 SASI_Mm02_00346149 predicted 818
8 SASI_Mm01_00100574 predicted 1115
9 SASI_Mm01_00100575 predicted 563
10 SASI_Mm01_00100577 predicted 2403
11 SASI_Mm01_00100568 predicted 731
12 SASI_Mm01_00100576 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175344
VALIDATED
ANO6 MISSION shRNA Bacterial Glycerol Stock
anoctamin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1576s21c1
Sequence:CCGGCTGTCCGTGTTCATCGTATTTCTCGAGAAATACGATGAACACGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-3657s21c1
Sequence:CCGGGTTGATCTGAACGGTTAATTTCTCGAGAAATTAACCGTTCAGATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1763s21c1
Sequence:CCGGCAAGGACCCAGACGGATTATGCTCGAGCATAATCCGTCTGGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2034s1c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-960s21c1
Sequence:CCGGGGCTCACCCTCGGAGTATATACTCGAGTATATACTCCGAGGGTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-2034s21c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175344.3-3306s1c1
Sequence:CCGGGCCTCTGTGTTATCAACAATACTCGAGTATTGTTGATAACACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-567s1c1
Sequence:CCGGGCACATCAAACTCCCGCTAAACTCGAGTTTAGCGGGAGTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2529s1c1
Sequence:CCGGCCCATACATTGGGCTTGGTAACTCGAGTTACCAAGCCCAATGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175344
VALIDATED
ANO6 MISSION shRNA shRNA Plasmid DNA
anoctamin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1576s21c1
Sequence:CCGGCTGTCCGTGTTCATCGTATTTCTCGAGAAATACGATGAACACGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-3657s21c1
Sequence:CCGGGTTGATCTGAACGGTTAATTTCTCGAGAAATTAACCGTTCAGATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1763s21c1
Sequence:CCGGCAAGGACCCAGACGGATTATGCTCGAGCATAATCCGTCTGGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2034s1c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-960s21c1
Sequence:CCGGGGCTCACCCTCGGAGTATATACTCGAGTATATACTCCGAGGGTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-2034s21c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175344.3-3306s1c1
Sequence:CCGGGCCTCTGTGTTATCAACAATACTCGAGTATTGTTGATAACACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-567s1c1
Sequence:CCGGGCACATCAAACTCCCGCTAAACTCGAGTTTAGCGGGAGTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2529s1c1
Sequence:CCGGCCCATACATTGGGCTTGGTAACTCGAGTTACCAAGCCCAATGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175344
VALIDATED
ANO6 MISSION shRNA Lentiviral Transduction Particles
anoctamin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1576s21c1
Sequence:CCGGCTGTCCGTGTTCATCGTATTTCTCGAGAAATACGATGAACACGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-3657s21c1
Sequence:CCGGGTTGATCTGAACGGTTAATTTCTCGAGAAATTAACCGTTCAGATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-1763s21c1
Sequence:CCGGCAAGGACCCAGACGGATTATGCTCGAGCATAATCCGTCTGGGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2034s1c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-960s21c1
Sequence:CCGGGGCTCACCCTCGGAGTATATACTCGAGTATATACTCCGAGGGTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175344.3-2034s21c1
Sequence:CCGGGAATCTAATTGGACGATATAACTCGAGTTATATCGTCCAATTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175344.3-3306s1c1
Sequence:CCGGGCCTCTGTGTTATCAACAATACTCGAGTATTGTTGATAACACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-567s1c1
Sequence:CCGGGCACATCAAACTCCCGCTAAACTCGAGTTTAGCGGGAGTTTGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175344.3-2529s1c1
Sequence:CCGGCCCATACATTGGGCTTGGTAACTCGAGTTACCAAGCCCAATGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025356
VALIDATED
ANO6 MISSION shRNA Bacterial Glycerol Stock
anoctamin 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-5012s1c1
Sequence:CCGGGCCATGTATGTCAGCATAGAACTCGAGTTCTATGCTGACATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1475s1c1
Sequence:CCGGCGATGTACTCACGTAGTGATACTCGAGTATCACTACGTGAGTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025356.1-398s1c1
Sequence:CCGGCAGCGAAGAATTGACTTTGTTCTCGAGAACAAAGTCAATTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-2846s1c1
Sequence:CCGGCACCTCAAAGATATGACGAAACTCGAGTTTCGTCATATCTTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1604s1c1
Sequence:CCGGGCTTCAGTTATTGGGATCATTCTCGAGAATGATCCCAATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1050s1c1
Sequence:CCGGCCTTGGATCTTATCAGGAAATCTCGAGATTTCCTGATAAGATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025356
VALIDATED
ANO6 MISSION shRNA shRNA Plasmid DNA
anoctamin 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-5012s1c1
Sequence:CCGGGCCATGTATGTCAGCATAGAACTCGAGTTCTATGCTGACATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1475s1c1
Sequence:CCGGCGATGTACTCACGTAGTGATACTCGAGTATCACTACGTGAGTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025356.1-398s1c1
Sequence:CCGGCAGCGAAGAATTGACTTTGTTCTCGAGAACAAAGTCAATTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-2846s1c1
Sequence:CCGGCACCTCAAAGATATGACGAAACTCGAGTTTCGTCATATCTTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1604s1c1
Sequence:CCGGGCTTCAGTTATTGGGATCATTCTCGAGAATGATCCCAATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1050s1c1
Sequence:CCGGCCTTGGATCTTATCAGGAAATCTCGAGATTTCCTGATAAGATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025356
VALIDATED
ANO6 MISSION shRNA Lentiviral Transduction Particles
anoctamin 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-5012s1c1
Sequence:CCGGGCCATGTATGTCAGCATAGAACTCGAGTTCTATGCTGACATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1475s1c1
Sequence:CCGGCGATGTACTCACGTAGTGATACTCGAGTATCACTACGTGAGTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025356.1-398s1c1
Sequence:CCGGCAGCGAAGAATTGACTTTGTTCTCGAGAACAAAGTCAATTCTTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-2846s1c1
Sequence:CCGGCACCTCAAAGATATGACGAAACTCGAGTTTCGTCATATCTTTGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1604s1c1
Sequence:CCGGGCTTCAGTTATTGGGATCATTCTCGAGAATGATCCCAATAACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001025356.1-1050s1c1
Sequence:CCGGCCTTGGATCTTATCAGGAAATCTCGAGATTTCCTGATAAGATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks