EMAIL THIS PAGE TO A FRIEND

ANO7

anoctamin 7

57 Gene Product Result for
Synonyms: D-TMPP DTMPP IPCA-5 IPCA5 NGEP PCANAP5 PCANAP5L TMEM16G
UniProtKB ID: Q6IWH7, Q6IWH6
Gene ID:
Human(50636) Summary: This prostate-specific gene encodes a cytoplasmic protein, as well as a polytopic membrane protein which may serve as a target in prostate cancer diagnosis and immunotherapy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2011]
Mouse(404545) anoctamin 7
Rat(367318) anoctamin 7
Zebrafish(556876) anoctamin 7
Horse(100067683) anoctamin 7
dog(486204) anoctamin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000451 MISSION® esiRNA esiRNA targeting mouse Ano7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001666 Rosetta Predictions human pricing
NM_001001891 Rosetta Predictions human pricing
NM_001004071 Rosetta Predictions rat pricing
NM_207031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018494 predicted 472
2 SASI_Hs01_00018495 predicted 416
3 SASI_Hs01_00018496 predicted 215
4 SASI_Hs01_00018497 predicted 603
5 SASI_Hs01_00018498 predicted 198
6 SASI_Hs01_00018499 predicted 615
7 SASI_Hs01_00018500 predicted 615
8 SASI_Hs01_00018501 predicted 426
9 SASI_Hs01_00018502 predicted 633
10 SASI_Hs01_00018503 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204868 predicted 830
2 SASI_Hs01_00204870 predicted 1921
3 SASI_Hs01_00204869 predicted 2336
4 SASI_Hs01_00204871 predicted 2092
5 SASI_Hs01_00204872 predicted 1949
6 SASI_Hs01_00204873 predicted 1458
7 SASI_Hs01_00204874 predicted 1962
8 SASI_Hs02_00303976 predicted 2213
9 SASI_Hs01_00204875 predicted 1844
10 SASI_Hs01_00204876 predicted 1228
11 SASI_Hs01_00204877 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034145 predicted 1507
2 SASI_Rn01_00034146 predicted 2198
3 SASI_Rn01_00034149 predicted 1842
4 SASI_Rn01_00034150 predicted 801
5 SASI_Rn02_00198091 predicted 652
6 SASI_Rn01_00034152 predicted 1340
7 SASI_Rn01_00034153 predicted 773
8 SASI_Rn01_00034154 predicted 386
9 SASI_Rn02_00198092 predicted 2050
10 SASI_Rn02_00198093 predicted 1550
11 SASI_Rn01_00034147 predicted 715
12 SASI_Rn01_00034148 predicted 2113
13 SASI_Rn01_00034151 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113590 predicted 1789
2 SASI_Mm01_00113591 predicted 2622
3 SASI_Mm01_00113592 predicted 1841
4 SASI_Mm01_00113593 predicted 677
5 SASI_Mm01_00113594 predicted 1094
6 SASI_Mm01_00113595 predicted 2203
7 SASI_Mm01_00113596 predicted 2518
8 SASI_Mm01_00113597 predicted 1476
9 SASI_Mm01_00113599 predicted 2049
10 SASI_Mm02_00351875 predicted 774
11 SASI_Mm01_00113598 predicted 2482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001891
ANO7 MISSION shRNA Bacterial Glycerol Stock
anoctamin 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1372s1c1
Sequence:CCGGCCGTGTTCTTCAGCTTGTTCACTCGAGTGAACAAGCTGAAGAACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2624s1c1
Sequence:CCGGCCAGACCTACTGGAATCTTCTCTCGAGAGAAGATTCCAGTAGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1871s1c1
Sequence:CCGGCAAGGTGTTCATCTTCCAGTTCTCGAGAACTGGAAGATGAACACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2216s1c1
Sequence:CCGGGTTTGACGAGTACCTGGAAATCTCGAGATTTCCAGGTACTCGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-869s1c1
Sequence:CCGGGCACCAAATTCTGTTTGAGATCTCGAGATCTCAAACAGAATTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-872s1c1
Sequence:CCGGCCAAATTCTGTTTGAGATCCTCTCGAGAGGATCTCAAACAGAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1883s1c1
Sequence:CCGGCTTCCAGTTCGTCAACTTCTACTCGAGTAGAAGTTGACGAACTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2054s1c1
Sequence:CCGGCAAGCAGGTCATCAACAACATCTCGAGATGTTGTTGATGACCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001891
ANO7 MISSION shRNA shRNA Plasmid DNA
anoctamin 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1372s1c1
Sequence:CCGGCCGTGTTCTTCAGCTTGTTCACTCGAGTGAACAAGCTGAAGAACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2624s1c1
Sequence:CCGGCCAGACCTACTGGAATCTTCTCTCGAGAGAAGATTCCAGTAGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1871s1c1
Sequence:CCGGCAAGGTGTTCATCTTCCAGTTCTCGAGAACTGGAAGATGAACACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2216s1c1
Sequence:CCGGGTTTGACGAGTACCTGGAAATCTCGAGATTTCCAGGTACTCGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-869s1c1
Sequence:CCGGGCACCAAATTCTGTTTGAGATCTCGAGATCTCAAACAGAATTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-872s1c1
Sequence:CCGGCCAAATTCTGTTTGAGATCCTCTCGAGAGGATCTCAAACAGAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1883s1c1
Sequence:CCGGCTTCCAGTTCGTCAACTTCTACTCGAGTAGAAGTTGACGAACTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2054s1c1
Sequence:CCGGCAAGCAGGTCATCAACAACATCTCGAGATGTTGTTGATGACCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001891
ANO7 MISSION shRNA Lentiviral Transduction Particles
anoctamin 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1372s1c1
Sequence:CCGGCCGTGTTCTTCAGCTTGTTCACTCGAGTGAACAAGCTGAAGAACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2624s1c1
Sequence:CCGGCCAGACCTACTGGAATCTTCTCTCGAGAGAAGATTCCAGTAGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1871s1c1
Sequence:CCGGCAAGGTGTTCATCTTCCAGTTCTCGAGAACTGGAAGATGAACACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2216s1c1
Sequence:CCGGGTTTGACGAGTACCTGGAAATCTCGAGATTTCCAGGTACTCGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-869s1c1
Sequence:CCGGGCACCAAATTCTGTTTGAGATCTCGAGATCTCAAACAGAATTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-872s1c1
Sequence:CCGGCCAAATTCTGTTTGAGATCCTCTCGAGAGGATCTCAAACAGAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-1883s1c1
Sequence:CCGGCTTCCAGTTCGTCAACTTCTACTCGAGTAGAAGTTGACGAACTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001891.1-2054s1c1
Sequence:CCGGCAAGCAGGTCATCAACAACATCTCGAGATGTTGTTGATGACCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207031
ANO7 MISSION shRNA Bacterial Glycerol Stock
anoctamin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-1794s1c1
Sequence:CCGGCGTGTATATCGCCTTCTTCAACTCGAGTTGAAGAAGGCGATATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2080s1c1
Sequence:CCGGCTGTTTCACGAATACCTTGAACTCGAGTTCAAGGTATTCGTGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2622s1c1
Sequence:CCGGGCGGGAATACTATTTAGCTAACTCGAGTTAGCTAAATAGTATTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-3002s1c1
Sequence:CCGGGAGCAGTGTTTAGAGAGTTATCTCGAGATAACTCTCTAAACACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-2911s1c1
Sequence:CCGGCCCTTGGTTTAGAATAACCATCTCGAGATGGTTATTCTAAACCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207031
ANO7 MISSION shRNA shRNA Plasmid DNA
anoctamin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-1794s1c1
Sequence:CCGGCGTGTATATCGCCTTCTTCAACTCGAGTTGAAGAAGGCGATATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2080s1c1
Sequence:CCGGCTGTTTCACGAATACCTTGAACTCGAGTTCAAGGTATTCGTGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2622s1c1
Sequence:CCGGGCGGGAATACTATTTAGCTAACTCGAGTTAGCTAAATAGTATTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-3002s1c1
Sequence:CCGGGAGCAGTGTTTAGAGAGTTATCTCGAGATAACTCTCTAAACACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-2911s1c1
Sequence:CCGGCCCTTGGTTTAGAATAACCATCTCGAGATGGTTATTCTAAACCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207031
ANO7 MISSION shRNA Lentiviral Transduction Particles
anoctamin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-1794s1c1
Sequence:CCGGCGTGTATATCGCCTTCTTCAACTCGAGTTGAAGAAGGCGATATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2080s1c1
Sequence:CCGGCTGTTTCACGAATACCTTGAACTCGAGTTCAAGGTATTCGTGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207031.1-2622s1c1
Sequence:CCGGGCGGGAATACTATTTAGCTAACTCGAGTTAGCTAAATAGTATTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-3002s1c1
Sequence:CCGGGAGCAGTGTTTAGAGAGTTATCTCGAGATAACTCTCTAAACACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207031.1-2911s1c1
Sequence:CCGGCCCTTGGTTTAGAATAACCATCTCGAGATGGTTATTCTAAACCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)