EMAIL THIS PAGE TO A FRIEND

ANO8

anoctamin 8

Synonyms: KIAA1623 TMEM16H
UniProtKB ID: Q9HCE9, A6NIJ0
Gene ID:
Mouse(382014) anoctamin 8
Rat(306340) anoctamin 8
Zebrafish(562782) anoctamin 8
cow(528201) anoctamin 8
dog(484839) anoctamin 8
chicken(429912) anoctamin 8
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020959 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020959 Rosetta Predictions human pricing
XM_224715 Rosetta Predictions rat pricing
XR_008586 Rosetta Predictions rat pricing
XM_889480 Rosetta Predictions mouse pricing
XM_898536 Rosetta Predictions mouse pricing
XM_898544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168353 predicted 867
2 SASI_Hs01_00168354 predicted 978
3 SASI_Hs01_00168355 predicted 1393
4 SASI_Hs01_00168356 predicted 2601
5 SASI_Hs01_00168357 predicted 2917
6 SASI_Hs01_00168359 predicted 2259
7 SASI_Hs01_00168360 predicted 960
8 SASI_Hs01_00168361 predicted 3071
9 SASI_Hs02_00354386 predicted 352
10 SASI_Hs02_00354387 predicted 796
11 SASI_Hs01_00168358 predicted 949
12 SASI_Hs01_00168362 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128512 predicted 1150
2 SASI_Rn01_00128513 predicted 1263
3 SASI_Rn01_00128514 predicted 1783
4 SASI_Rn01_00128515 predicted 1651
5 SASI_Rn01_00128516 predicted 1288
6 SASI_Rn01_00128517 predicted 946
7 SASI_Rn01_00128518 predicted 1224
8 SASI_Rn01_00128519 predicted 2897
9 SASI_Rn01_00128520 predicted 2699
10 SASI_Rn01_00128521 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151342 predicted 955
2 SASI_Rn01_00151343 predicted 1076
3 SASI_Rn01_00151344 predicted 1630
4 SASI_Rn01_00151345 predicted 1490
5 SASI_Rn01_00151346 predicted 1095
6 SASI_Rn01_00151347 predicted 1035
7 SASI_Rn01_00151348 predicted 2559
8 SASI_Rn01_00151349 predicted 2363
9 SASI_Rn01_00151350 predicted 1131
10 SASI_Rn01_00151351 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243460 predicted 906
2 SASI_Mm01_00243461 predicted 1438
3 SASI_Mm01_00243462 predicted 1033
4 SASI_Mm01_00243464 predicted 834
5 SASI_Mm01_00243465 predicted 2320
6 SASI_Mm01_00243466 predicted 903
7 SASI_Mm01_00243467 predicted 925
8 SASI_Mm02_00428785 predicted 1560
9 SASI_Mm01_00243468 predicted 1587
10 SASI_Mm01_00243469 predicted 845
11 SASI_Mm01_00243463 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284993 predicted 460
2 SASI_Mm01_00284994 predicted 468
3 SASI_Mm01_00284995 predicted 1290
4 SASI_Mm01_00284996 predicted 1416
5 SASI_Mm01_00284997 predicted 496
6 SASI_Mm01_00284998 predicted 597
7 SASI_Mm01_00284999 predicted 1405
8 SASI_Mm01_00285000 predicted 594
9 SASI_Mm01_00285001 predicted 1351
10 SASI_Mm01_00285002 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269212 predicted 606
2 SASI_Mm01_00269213 predicted 1136
3 SASI_Mm01_00269214 predicted 730
4 SASI_Mm01_00269215 predicted 1143
5 SASI_Mm01_00269216 predicted 2017
6 SASI_Mm01_00269217 predicted 598
7 SASI_Mm01_00269218 predicted 623
8 SASI_Mm01_00269219 predicted 2224
9 SASI_Mm01_00269220 predicted 1256
10 SASI_Mm01_00269221 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020959
ANO8 MISSION shRNA Bacterial Glycerol Stock
anoctamin 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1047s1c1
Sequence:CCGGGCTGTTCCTAGAGGAATGGAACTCGAGTTCCATTCCTCTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-2607s1c1
Sequence:CCGGGATTGTGGTCAACTGCTACTTCTCGAGAAGTAGCAGTTGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-1470s1c1
Sequence:CCGGCATCATCAAAGTTGTCCTGTTCTCGAGAACAGGACAACTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-3084s1c1
Sequence:CCGGCATGAAGTTGAAGCAGATCATCTCGAGATGATCTGCTTCAACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-856s1c1
Sequence:CCGGCCTCTAGATGACATCTGTGATCTCGAGATCACAGATGTCATCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-3081s1c1
Sequence:CCGGCGTCATGAAGTTGAAGCAGATCTCGAGATCTGCTTCAACTTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1263s1c1
Sequence:CCGGCGTCTGTGTCTTCTTGCTCATCTCGAGATGAGCAAGAAGACACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020959.1-3997s1c1
Sequence:CCGGCCAAACGAAAGGAAACCCACACTCGAGTGTGGGTTTCCTTTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-1406s21c1
Sequence:CCGGAGCTAGCCATCTGGCTCAATGCTCGAGCATTGAGCCAGATGGCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-3103s21c1
Sequence:CCGGATCCCACTGCAGGGCAAATTCCTCGAGGAATTTGCCCTGCAGTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-955s21c1
Sequence:CCGGGGGTCTGTCCTGTACACATTCCTCGAGGAATGTGTACAGGACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-987s21c1
Sequence:CCGGTCAGACAAGCCGGGATGTTTCCTCGAGGAAACATCCCGGCTTGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020959
ANO8 MISSION shRNA shRNA Plasmid DNA
anoctamin 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1047s1c1
Sequence:CCGGGCTGTTCCTAGAGGAATGGAACTCGAGTTCCATTCCTCTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-2607s1c1
Sequence:CCGGGATTGTGGTCAACTGCTACTTCTCGAGAAGTAGCAGTTGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-1470s1c1
Sequence:CCGGCATCATCAAAGTTGTCCTGTTCTCGAGAACAGGACAACTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-3084s1c1
Sequence:CCGGCATGAAGTTGAAGCAGATCATCTCGAGATGATCTGCTTCAACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-856s1c1
Sequence:CCGGCCTCTAGATGACATCTGTGATCTCGAGATCACAGATGTCATCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-3081s1c1
Sequence:CCGGCGTCATGAAGTTGAAGCAGATCTCGAGATCTGCTTCAACTTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1263s1c1
Sequence:CCGGCGTCTGTGTCTTCTTGCTCATCTCGAGATGAGCAAGAAGACACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020959.1-3997s1c1
Sequence:CCGGCCAAACGAAAGGAAACCCACACTCGAGTGTGGGTTTCCTTTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-1406s21c1
Sequence:CCGGAGCTAGCCATCTGGCTCAATGCTCGAGCATTGAGCCAGATGGCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-3103s21c1
Sequence:CCGGATCCCACTGCAGGGCAAATTCCTCGAGGAATTTGCCCTGCAGTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-955s21c1
Sequence:CCGGGGGTCTGTCCTGTACACATTCCTCGAGGAATGTGTACAGGACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-987s21c1
Sequence:CCGGTCAGACAAGCCGGGATGTTTCCTCGAGGAAACATCCCGGCTTGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020959
ANO8 MISSION shRNA Lentiviral Transduction Particles
anoctamin 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1047s1c1
Sequence:CCGGGCTGTTCCTAGAGGAATGGAACTCGAGTTCCATTCCTCTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-2607s1c1
Sequence:CCGGGATTGTGGTCAACTGCTACTTCTCGAGAAGTAGCAGTTGACCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-1470s1c1
Sequence:CCGGCATCATCAAAGTTGTCCTGTTCTCGAGAACAGGACAACTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020959.1-3084s1c1
Sequence:CCGGCATGAAGTTGAAGCAGATCATCTCGAGATGATCTGCTTCAACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-856s1c1
Sequence:CCGGCCTCTAGATGACATCTGTGATCTCGAGATCACAGATGTCATCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-3081s1c1
Sequence:CCGGCGTCATGAAGTTGAAGCAGATCTCGAGATCTGCTTCAACTTCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020959.1-1263s1c1
Sequence:CCGGCGTCTGTGTCTTCTTGCTCATCTCGAGATGAGCAAGAAGACACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020959.1-3997s1c1
Sequence:CCGGCCAAACGAAAGGAAACCCACACTCGAGTGTGGGTTTCCTTTCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-1406s21c1
Sequence:CCGGAGCTAGCCATCTGGCTCAATGCTCGAGCATTGAGCCAGATGGCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-3103s21c1
Sequence:CCGGATCCCACTGCAGGGCAAATTCCTCGAGGAATTTGCCCTGCAGTGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-955s21c1
Sequence:CCGGGGGTCTGTCCTGTACACATTCCTCGAGGAATGTGTACAGGACAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020959.2-987s21c1
Sequence:CCGGTCAGACAAGCCGGGATGTTTCCTCGAGGAAACATCCCGGCTTGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks