EMAIL THIS PAGE TO A FRIEND

ANO9

anoctamin 9

56 Gene Product Result for
Synonyms: PIG5 TMEM16J TP53I5
UniProtKB ID: A1A5B4, B3KUC4, B4E134, Q8TEN4
Gene ID:
Mouse(71345) anoctamin 9
Rat(499287) anoctamin 9
chicken(422996) anoctamin 9
cow(512371) anoctamin 9
Horse(100054456) anoctamin 9
dog(483400) anoctamin 9
sheep(101105118) anoctamin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012302 Rosetta Predictions human pricing
XM_001062059 Rosetta Predictions rat pricing
XM_574586 Rosetta Predictions rat pricing
NM_178381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075264 predicted 704
2 SASI_Hs01_00075265 predicted 1809
3 SASI_Hs01_00075267 predicted 1090
4 SASI_Hs01_00075268 predicted 1976
5 SASI_Hs01_00075269 predicted 1988
6 SASI_Hs01_00075270 predicted 265
7 SASI_Hs01_00075271 predicted 602
8 SASI_Hs01_00075273 predicted 1977
9 SASI_Hs02_00306075 predicted 1977
10 SASI_Hs02_00306076 predicted 1372
11 SASI_Hs01_00075266 predicted 952
12 SASI_Hs01_00075272 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302227 predicted 1978
2 SASI_Rn02_00302228 predicted 789
3 SASI_Rn02_00302229 predicted 1774
4 SASI_Rn02_00302230 predicted 1065
5 SASI_Rn02_00302231 predicted 1297
6 SASI_Rn02_00302232 predicted 854
7 SASI_Rn02_00302233 predicted 1352
8 SASI_Rn02_00302234 predicted 1567
9 SASI_Rn02_00302235 predicted 790
10 SASI_Rn02_00302236 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402252 predicted 1975
2 SASI_Rn02_00402253 predicted 790
3 SASI_Rn02_00402254 predicted 1773
4 SASI_Rn02_00402255 predicted 1073
5 SASI_Rn02_00402256 predicted 1299
6 SASI_Rn02_00402257 predicted 859
7 SASI_Rn02_00402258 predicted 1357
8 SASI_Rn02_00402259 predicted 1568
9 SASI_Rn02_00402260 predicted 793
10 SASI_Rn02_00402261 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348782 predicted 1555
2 SASI_Mm01_00033864 predicted 952
3 SASI_Mm02_00348783 predicted 342
4 SASI_Mm01_00033866 predicted 1108
5 SASI_Mm02_00348784 predicted 1945
6 SASI_Mm01_00033867 predicted 1210
7 SASI_Mm02_00348785 predicted 1223
8 SASI_Mm02_00348786 predicted 2420
9 SASI_Mm01_00033869 predicted 1001
10 SASI_Mm02_00348787 predicted 2104
11 SASI_Mm01_00033863 predicted 271
12 SASI_Mm01_00033865 predicted 838
13 SASI_Mm01_00033868 predicted 1101
14 SASI_Mm01_00033870 predicted 1172
15 SASI_Mm01_00033871 predicted 1368
16 SASI_Mm01_00033872 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178381
ANO9 MISSION shRNA Bacterial Glycerol Stock
anoctamin 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1692s21c1
Sequence:CCGGGATGATCCAGTACGGCTTTACCTCGAGGTAAAGCCGTACTGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178381.3-2717s1c1
Sequence:CCGGGAATGACCCTAGTACCTATAGCTCGAGCTATAGGTACTAGGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.3-422s1c1
Sequence:CCGGCTACCACAAGAATCCGAATTGCTCGAGCAATTCGGATTCTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1891s21c1
Sequence:CCGGATTGCCAATGGAATGGTTATCCTCGAGGATAACCATTCCATTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2716s21c1
Sequence:CCGGTGAATGACCCTAGTACCTATACTCGAGTATAGGTACTAGGGTCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2615s21c1
Sequence:CCGGCCATGTATATTTAGGGTATTTCTCGAGAAATACCCTAAATATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1547s21c1
Sequence:CCGGGCCCGTTGTTGGCCCATAAATCTCGAGATTTATGGGCCAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-413s1c1
Sequence:CCGGCAGCCAGATCAGCAAAGAGATCTCGAGATCTCTTTGCTGATCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-278s1c1
Sequence:CCGGGCTTTCCCACAGGGAATACTTCTCGAGAAGTATTCCCTGTGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-447s1c1
Sequence:CCGGGATATCTTCATGTGCCCTCTTCTCGAGAAGAGGGCACATGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-846s1c1
Sequence:CCGGGATCTGTTTAATGATTGGCATCTCGAGATGCCAATCATTAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-425s1c1
Sequence:CCGGCAAAGAGATCTGTAGTGCCAACTCGAGTTGGCACTACAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-551s1c1
Sequence:CCGGCGTGCTATTTGCCATCTTCATCTCGAGATGAAGATGGCAAATAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178381
ANO9 MISSION shRNA shRNA Plasmid DNA
anoctamin 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1692s21c1
Sequence:CCGGGATGATCCAGTACGGCTTTACCTCGAGGTAAAGCCGTACTGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178381.3-2717s1c1
Sequence:CCGGGAATGACCCTAGTACCTATAGCTCGAGCTATAGGTACTAGGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.3-422s1c1
Sequence:CCGGCTACCACAAGAATCCGAATTGCTCGAGCAATTCGGATTCTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1891s21c1
Sequence:CCGGATTGCCAATGGAATGGTTATCCTCGAGGATAACCATTCCATTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2716s21c1
Sequence:CCGGTGAATGACCCTAGTACCTATACTCGAGTATAGGTACTAGGGTCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2615s21c1
Sequence:CCGGCCATGTATATTTAGGGTATTTCTCGAGAAATACCCTAAATATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1547s21c1
Sequence:CCGGGCCCGTTGTTGGCCCATAAATCTCGAGATTTATGGGCCAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-413s1c1
Sequence:CCGGCAGCCAGATCAGCAAAGAGATCTCGAGATCTCTTTGCTGATCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-278s1c1
Sequence:CCGGGCTTTCCCACAGGGAATACTTCTCGAGAAGTATTCCCTGTGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-447s1c1
Sequence:CCGGGATATCTTCATGTGCCCTCTTCTCGAGAAGAGGGCACATGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-846s1c1
Sequence:CCGGGATCTGTTTAATGATTGGCATCTCGAGATGCCAATCATTAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-425s1c1
Sequence:CCGGCAAAGAGATCTGTAGTGCCAACTCGAGTTGGCACTACAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-551s1c1
Sequence:CCGGCGTGCTATTTGCCATCTTCATCTCGAGATGAAGATGGCAAATAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178381
ANO9 MISSION shRNA Lentiviral Transduction Particles
anoctamin 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1692s21c1
Sequence:CCGGGATGATCCAGTACGGCTTTACCTCGAGGTAAAGCCGTACTGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178381.3-2717s1c1
Sequence:CCGGGAATGACCCTAGTACCTATAGCTCGAGCTATAGGTACTAGGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.3-422s1c1
Sequence:CCGGCTACCACAAGAATCCGAATTGCTCGAGCAATTCGGATTCTTGTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1891s21c1
Sequence:CCGGATTGCCAATGGAATGGTTATCCTCGAGGATAACCATTCCATTGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2716s21c1
Sequence:CCGGTGAATGACCCTAGTACCTATACTCGAGTATAGGTACTAGGGTCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178381.3-2615s21c1
Sequence:CCGGCCATGTATATTTAGGGTATTTCTCGAGAAATACCCTAAATATACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178381.3-1547s21c1
Sequence:CCGGGCCCGTTGTTGGCCCATAAATCTCGAGATTTATGGGCCAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-413s1c1
Sequence:CCGGCAGCCAGATCAGCAAAGAGATCTCGAGATCTCTTTGCTGATCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-278s1c1
Sequence:CCGGGCTTTCCCACAGGGAATACTTCTCGAGAAGTATTCCCTGTGGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-447s1c1
Sequence:CCGGGATATCTTCATGTGCCCTCTTCTCGAGAAGAGGGCACATGAAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-846s1c1
Sequence:CCGGGATCTGTTTAATGATTGGCATCTCGAGATGCCAATCATTAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178381.2-425s1c1
Sequence:CCGGCAAAGAGATCTGTAGTGCCAACTCGAGTTGGCACTACAGATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178381.2-551s1c1
Sequence:CCGGCGTGCTATTTGCCATCTTCATCTCGAGATGAAGATGGCAAATAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012302
ANO9 MISSION shRNA Bacterial Glycerol Stock
anoctamin 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-2121s21c1
Sequence:CCGGGATACAGGGACTACCGCAATCCTCGAGGATTGCGGTAGTCCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-1007s21c1
Sequence:CCGGATGGCACTTCAGCTCATTAACCTCGAGGTTAATGAGCTGAAGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-723s21c1
Sequence:CCGGTGAGCGGATTCTCGCTGTTTGCTCGAGCAAACAGCGAGAATCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-951s1c1
Sequence:CCGGGAAATGGCACTTCAGCTCATTCTCGAGAATGAGCTGAAGTGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-554s1c1
Sequence:CCGGGCCAGTTGATGAAATCAGGAACTCGAGTTCCTGATTTCATCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-398s1c1
Sequence:CCGGCGTGAACTTCGTTGTCATGAACTCGAGTTCATGACAACGAAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1322s1c1
Sequence:CCGGCACCCATTTCTCGTCTCTCATCTCGAGATGAGAGACGAGAAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1187s1c1
Sequence:CCGGGCACTATGTGACCATCGTCATCTCGAGATGACGATGGTCACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-2093s1c1
Sequence:CCGGCGATTACAACTTCTCCGAGCACTCGAGTGCTCGGAGAAGTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-281s1c1
Sequence:CCGGCAACAGTGTCTTTGGCCTGTACTCGAGTACAGGCCAAAGACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012302
ANO9 MISSION shRNA shRNA Plasmid DNA
anoctamin 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-2121s21c1
Sequence:CCGGGATACAGGGACTACCGCAATCCTCGAGGATTGCGGTAGTCCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-1007s21c1
Sequence:CCGGATGGCACTTCAGCTCATTAACCTCGAGGTTAATGAGCTGAAGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-723s21c1
Sequence:CCGGTGAGCGGATTCTCGCTGTTTGCTCGAGCAAACAGCGAGAATCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-951s1c1
Sequence:CCGGGAAATGGCACTTCAGCTCATTCTCGAGAATGAGCTGAAGTGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-554s1c1
Sequence:CCGGGCCAGTTGATGAAATCAGGAACTCGAGTTCCTGATTTCATCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-398s1c1
Sequence:CCGGCGTGAACTTCGTTGTCATGAACTCGAGTTCATGACAACGAAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1322s1c1
Sequence:CCGGCACCCATTTCTCGTCTCTCATCTCGAGATGAGAGACGAGAAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1187s1c1
Sequence:CCGGGCACTATGTGACCATCGTCATCTCGAGATGACGATGGTCACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-2093s1c1
Sequence:CCGGCGATTACAACTTCTCCGAGCACTCGAGTGCTCGGAGAAGTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-281s1c1
Sequence:CCGGCAACAGTGTCTTTGGCCTGTACTCGAGTACAGGCCAAAGACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012302
ANO9 MISSION shRNA Lentiviral Transduction Particles
anoctamin 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-2121s21c1
Sequence:CCGGGATACAGGGACTACCGCAATCCTCGAGGATTGCGGTAGTCCCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-1007s21c1
Sequence:CCGGATGGCACTTCAGCTCATTAACCTCGAGGTTAATGAGCTGAAGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012302.2-723s21c1
Sequence:CCGGTGAGCGGATTCTCGCTGTTTGCTCGAGCAAACAGCGAGAATCCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-951s1c1
Sequence:CCGGGAAATGGCACTTCAGCTCATTCTCGAGAATGAGCTGAAGTGCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-554s1c1
Sequence:CCGGGCCAGTTGATGAAATCAGGAACTCGAGTTCCTGATTTCATCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-398s1c1
Sequence:CCGGCGTGAACTTCGTTGTCATGAACTCGAGTTCATGACAACGAAGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1322s1c1
Sequence:CCGGCACCCATTTCTCGTCTCTCATCTCGAGATGAGAGACGAGAAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-1187s1c1
Sequence:CCGGGCACTATGTGACCATCGTCATCTCGAGATGACGATGGTCACATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-2093s1c1
Sequence:CCGGCGATTACAACTTCTCCGAGCACTCGAGTGCTCGGAGAAGTTGTAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012302.1-281s1c1
Sequence:CCGGCAACAGTGTCTTTGGCCTGTACTCGAGTACAGGCCAAAGACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks