EMAIL THIS PAGE TO A FRIEND

ANP32B

acidic (leucine-rich) nuclear phosphoprotein 32 family, member B

Synonyms: APRIL PHAPI2 SSP29
UniProtKB ID: Q92688, B2R9C7, O00655, P78458, P78459
Gene ID:
Mouse(67628) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Rat(170724) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Zebrafish(322000) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
cow(509685) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
domestic cat(101092059) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
dog(474775) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
chicken(420087) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
domestic guinea pig(100713288) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
naked mole-rat(101722289) acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0382 AQUA Peptide IEGLTDETY[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006401 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006401 Rosetta Predictions human pricing
NM_131911 Rosetta Predictions rat pricing
NM_130889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341478 predicted 450
2 SASI_Hs02_00341479 predicted 454
3 SASI_Hs02_00341480 predicted 478
4 SASI_Hs02_00341481 predicted 454
5 SASI_Hs02_00341482 predicted 577
6 SASI_Hs02_00341483 predicted 507
7 SASI_Hs02_00341484 predicted 477
8 SASI_Hs02_00341485 predicted 501
9 SASI_Hs02_00341486 predicted 585
10 SASI_Hs02_00341487 predicted 495
11 SASI_Hs01_00103017 predicted 977
12 SASI_Hs01_00103018 predicted 1133
13 SASI_Hs01_00103019 predicted 597
14 SASI_Hs01_00103020 predicted 1095
15 SASI_Hs01_00103021 predicted 1206
16 SASI_Hs01_00103022 predicted 1003
17 SASI_Hs01_00103023 predicted 580
18 SASI_Hs01_00103024 predicted 1116
19 SASI_Hs01_00103025 predicted 996
20 SASI_Hs01_00103026 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108924 predicted 297
2 SASI_Rn01_00108925 predicted 400
3 SASI_Rn01_00108926 predicted 276
4 SASI_Rn01_00108927 predicted 347
5 SASI_Rn01_00108928 predicted 475
6 SASI_Rn02_00267540 predicted 350
7 SASI_Rn01_00108929 predicted 225
8 SASI_Rn01_00108930 predicted 445
9 SASI_Rn01_00108931 predicted 433
10 SASI_Rn01_00108932 predicted 450
11 SASI_Rn01_00108933 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338324 predicted 235
2 SASI_Mm02_00338325 predicted 234
3 SASI_Mm02_00338326 predicted 234
4 SASI_Mm02_00338327 predicted 227
5 SASI_Mm01_00100998 predicted 485
6 SASI_Mm01_00100999 predicted 304
7 SASI_Mm01_00101000 predicted 459
8 SASI_Mm01_00101001 predicted 278
9 SASI_Mm01_00101002 predicted 360
10 SASI_Mm02_00338328 predicted 308
11 SASI_Mm01_00101003 predicted 517
12 SASI_Mm01_00101004 predicted 391
13 SASI_Mm01_00101005 predicted 386
14 SASI_Mm01_00101006 predicted 486
15 SASI_Mm01_00101007 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130889
VALIDATED
ANP32B MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-655s21c1
Sequence:CCGGATGTGGAGGTGGATAGTGTAGCTCGAGCTACACTATCCACCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-1049s21c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-360s21c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-243s21c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-269s1c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-887s1c1
Sequence:CCGGGAAGAAGAATTTGGACATGATCTCGAGATCATGTCCAAATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130889.1-629s1c1
Sequence:CCGGCTGTCCTATCTGGATGGCTATCTCGAGATAGCCATCCAGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-386s1c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-1075s1c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130889
VALIDATED
ANP32B MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-655s21c1
Sequence:CCGGATGTGGAGGTGGATAGTGTAGCTCGAGCTACACTATCCACCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-1049s21c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-360s21c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-243s21c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-269s1c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-887s1c1
Sequence:CCGGGAAGAAGAATTTGGACATGATCTCGAGATCATGTCCAAATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130889.1-629s1c1
Sequence:CCGGCTGTCCTATCTGGATGGCTATCTCGAGATAGCCATCCAGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-386s1c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-1075s1c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130889
VALIDATED
ANP32B MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-655s21c1
Sequence:CCGGATGTGGAGGTGGATAGTGTAGCTCGAGCTACACTATCCACCTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-1049s21c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-360s21c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130889.2-243s21c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-269s1c1
Sequence:CCGGCTTGTCTTGGACAATTGCAAACTCGAGTTTGCAATTGTCCAAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-887s1c1
Sequence:CCGGGAAGAAGAATTTGGACATGATCTCGAGATCATGTCCAAATTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130889.1-629s1c1
Sequence:CCGGCTGTCCTATCTGGATGGCTATCTCGAGATAGCCATCCAGATAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-386s1c1
Sequence:CCGGCCGAAGCTACCTAAGTTGAAACTCGAGTTTCAACTTAGGTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130889.1-1075s1c1
Sequence:CCGGCTCATGGATTTGGTAGCTGTTCTCGAGAACAGCTACCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006401
VALIDATED
ANP32B MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-452s21c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-772s21c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-989s21c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-1223s21c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-1084s1c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-279s1c1
Sequence:CCGGCTTGGACAATTGCAAATCAAACTCGAGTTTGATTTGCAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-313s1c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-850s1c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-633s1c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006401
VALIDATED
ANP32B MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-452s21c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-772s21c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-989s21c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-1223s21c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-1084s1c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-279s1c1
Sequence:CCGGCTTGGACAATTGCAAATCAAACTCGAGTTTGATTTGCAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-313s1c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-850s1c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-633s1c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006401
VALIDATED
ANP32B MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-452s21c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-772s21c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-989s21c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006401.2-1223s21c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-1084s1c1
Sequence:CCGGCCACCCAAAGAGCCAAAGAATCTCGAGATTCTTTGGCTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-279s1c1
Sequence:CCGGCTTGGACAATTGCAAATCAAACTCGAGTTTGATTTGCAATTGTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-313s1c1
Sequence:CCGGGAGGGCTTAACAGCTGAATTTCTCGAGAAATTCAGCTGTTAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-850s1c1
Sequence:CCGGGAAGAATTTGGACTTGATGAACTCGAGTTCATCAAGTCCAAATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006401.1-633s1c1
Sequence:CCGGGCTTACCTACTTGGATGGCTACTCGAGTAGCCATCCAAGTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks