EMAIL THIS PAGE TO A FRIEND

ANP32C

acidic (leucine-rich) nuclear phosphoprotein 32 family, member C

22 Gene Product Result for
Synonyms: PP32R1
Species: Human ANP32C(23520)
UniProtKB ID: O43423, Q4W5F9
Gene ID:
Human(23520) Summary: Phosphoprotein 32 (PP32) is a tumor suppressor that can inhibit several types of cancers, including prostate and breast cancers. The protein encoded by this gene is one of at least two proteins that are similar in amino acid sequence to PP32 and are part of the same acidic nuclear phosphoprotein gene family. However, unlike PP32, the encoded protein is tumorigenic. The tumor suppressor function of PP32 has been localized to a 25 amino acid region that is divergent between PP32 and the protein encoded by this gene. This gene does not contain introns. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012403 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012403 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022383 predicted 241
2 SASI_Hs01_00022386 predicted 248
3 SASI_Hs01_00022387 predicted 247
4 SASI_Hs02_00344236 predicted 191
5 SASI_Hs02_00344237 predicted 426
6 SASI_Hs02_00344238 predicted 411
7 SASI_Hs02_00344239 predicted 158
8 SASI_Hs02_00344240 predicted 166
9 SASI_Hs02_00344241 predicted 193
10 SASI_Hs01_00022382 predicted 255
11 SASI_Hs01_00022384 predicted 257
12 SASI_Hs01_00022385 predicted 259
13 SASI_Hs01_00022388 predicted 309
14 SASI_Hs01_00022389 predicted 306
15 SASI_Hs01_00022390 predicted 250
16 SASI_Hs01_00022391 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012403
ANP32C MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-261s1c1
Sequence:CCGGGCATCTATATTTAAGTGGCAACTCGAGTTGCCACTTAAATATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-453s1c1
Sequence:CCGGCCCTTACTCAGATATTGAGGACTCGAGTCCTCAATATCTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-106s1c1
Sequence:CCGGGCCCTCACAGATGAATTTGAACTCGAGTTCAAATTCATCTGTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-197s1c1
Sequence:CCGGGAAAGCTTGAACTAAGAGTCTCTCGAGAGACTCTTAGTTCAAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-454s21c1
Sequence:CCGGCCTTACTCAGATATTGAGGACCTCGAGGTCCTCAATATCTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-249s21c1
Sequence:CCGGTCCAAACCTCACGCATCTATACTCGAGTATAGATGCGTGAGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-415s21c1
Sequence:CCGGACATATCTCGACAGCTGTTACCTCGAGGTAACAGCTGTCGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-156s21c1
Sequence:CCGGAGGCCTCACCTCAATCTCAGACTCGAGTCTGAGATTGAGGTGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-192s21c1
Sequence:CCGGGTTGAGAAAGCTTGAACTAAGCTCGAGCTTAGTTCAAGCTTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012403
ANP32C MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-261s1c1
Sequence:CCGGGCATCTATATTTAAGTGGCAACTCGAGTTGCCACTTAAATATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-453s1c1
Sequence:CCGGCCCTTACTCAGATATTGAGGACTCGAGTCCTCAATATCTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-106s1c1
Sequence:CCGGGCCCTCACAGATGAATTTGAACTCGAGTTCAAATTCATCTGTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-197s1c1
Sequence:CCGGGAAAGCTTGAACTAAGAGTCTCTCGAGAGACTCTTAGTTCAAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-454s21c1
Sequence:CCGGCCTTACTCAGATATTGAGGACCTCGAGGTCCTCAATATCTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-249s21c1
Sequence:CCGGTCCAAACCTCACGCATCTATACTCGAGTATAGATGCGTGAGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-415s21c1
Sequence:CCGGACATATCTCGACAGCTGTTACCTCGAGGTAACAGCTGTCGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-156s21c1
Sequence:CCGGAGGCCTCACCTCAATCTCAGACTCGAGTCTGAGATTGAGGTGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-192s21c1
Sequence:CCGGGTTGAGAAAGCTTGAACTAAGCTCGAGCTTAGTTCAAGCTTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012403
ANP32C MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-261s1c1
Sequence:CCGGGCATCTATATTTAAGTGGCAACTCGAGTTGCCACTTAAATATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-453s1c1
Sequence:CCGGCCCTTACTCAGATATTGAGGACTCGAGTCCTCAATATCTGAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-106s1c1
Sequence:CCGGGCCCTCACAGATGAATTTGAACTCGAGTTCAAATTCATCTGTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012403.1-197s1c1
Sequence:CCGGGAAAGCTTGAACTAAGAGTCTCTCGAGAGACTCTTAGTTCAAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-454s21c1
Sequence:CCGGCCTTACTCAGATATTGAGGACCTCGAGGTCCTCAATATCTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-249s21c1
Sequence:CCGGTCCAAACCTCACGCATCTATACTCGAGTATAGATGCGTGAGGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-415s21c1
Sequence:CCGGACATATCTCGACAGCTGTTACCTCGAGGTAACAGCTGTCGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-156s21c1
Sequence:CCGGAGGCCTCACCTCAATCTCAGACTCGAGTCTGAGATTGAGGTGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012403.1-192s21c1
Sequence:CCGGGTTGAGAAAGCTTGAACTAAGCTCGAGCTTAGTTCAAGCTTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks