EMAIL THIS PAGE TO A FRIEND

ANP32D

acidic (leucine-rich) nuclear phosphoprotein 32 family, member D

18 Gene Product Result for
Synonyms: PP32R2
Species: Human ANP32D(23519)
UniProtKB ID: O95626, Q6NTC4
Gene ID:
Human(23519) Summary: Phosphoprotein 32 (PP32) is a tumor suppressor that can inhibit several types of cancers, including prostate and breast cancers. The protein encoded by this gene is one of at least two proteins that are similar in amino acid sequence to PP32 and are part of the same acidic nuclear phosphoprotein gene family. However, unlike PP32, the encoded protein is tumorigenic. The tumor suppressor function of PP32 has been localized to a 25 amino acid region that is absent in the protein encoded by this gene. This gene does not contain introns. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012404 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128461 MISSION® esiRNA esiRNA human ANP32D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245403 predicted 257
2 SASI_Hs02_00344242 predicted 256
3 SASI_Hs02_00344243 predicted 261
4 SASI_Hs01_00245404 predicted 70
5 SASI_Hs02_00344244 predicted 127
6 SASI_Hs02_00344245 predicted 260
7 SASI_Hs01_00245407 predicted 193
8 SASI_Hs01_00245408 predicted 226
9 SASI_Hs02_00344246 predicted 88
10 SASI_Hs01_00245411 predicted 60
11 SASI_Hs01_00245402 predicted 183
12 SASI_Hs01_00245405 predicted 151
13 SASI_Hs01_00245406 predicted 181
14 SASI_Hs01_00245409 predicted 201
15 SASI_Hs01_00245410 predicted 193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012404
ANP32D MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member D
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-108s1c1
Sequence:CCGGCCTCACAGATGAATTTGAAGACTCGAGTCTTCAAATTCATCTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-84s1c1
Sequence:CCGGGTCAAATGAAGGCAAATTGGACTCGAGTCCAATTTGCCTTCATTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-201s1c1
Sequence:CCGGGAAGCTTGAACTAAGCAGTAACTCGAGTTACTGCTTAGTTCAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-165s1c1
Sequence:CCGGCTCAATTGCAAACTTGCCAAACTCGAGTTTGGCAAGTTTGCAATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-236s1c1
Sequence:CCGGGCCTAGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-103s1c1
Sequence:CCGGGAAGGCCTCACAGATGAATTTCTCGAGAAATTCATCTGTGAGGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-146s1c1
Sequence:CCGGCAATCAACATAGGCCTCACCTCTCGAGAGGTGAGGCCTATGTTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-69s1c1
Sequence:CCGGCCTGGACAACAGTCAGTCAAACTCGAGTTTGACTGACTGTTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-96s1c1
Sequence:CCGGCAAATTGGAAGGCCTCACAGACTCGAGTCTGTGAGGCCTTCCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-159s1c1
Sequence:CCGGCCTCACCTCAATTGCAAACTTCTCGAGAAGTTTGCAATTGAGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-164s1c1
Sequence:CCGGCCTCAATTGCAAACTTGCCAACTCGAGTTGGCAAGTTTGCAATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012404
ANP32D MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member D
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-108s1c1
Sequence:CCGGCCTCACAGATGAATTTGAAGACTCGAGTCTTCAAATTCATCTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-84s1c1
Sequence:CCGGGTCAAATGAAGGCAAATTGGACTCGAGTCCAATTTGCCTTCATTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-201s1c1
Sequence:CCGGGAAGCTTGAACTAAGCAGTAACTCGAGTTACTGCTTAGTTCAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-165s1c1
Sequence:CCGGCTCAATTGCAAACTTGCCAAACTCGAGTTTGGCAAGTTTGCAATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-236s1c1
Sequence:CCGGGCCTAGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-103s1c1
Sequence:CCGGGAAGGCCTCACAGATGAATTTCTCGAGAAATTCATCTGTGAGGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-146s1c1
Sequence:CCGGCAATCAACATAGGCCTCACCTCTCGAGAGGTGAGGCCTATGTTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-69s1c1
Sequence:CCGGCCTGGACAACAGTCAGTCAAACTCGAGTTTGACTGACTGTTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-96s1c1
Sequence:CCGGCAAATTGGAAGGCCTCACAGACTCGAGTCTGTGAGGCCTTCCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-159s1c1
Sequence:CCGGCCTCACCTCAATTGCAAACTTCTCGAGAAGTTTGCAATTGAGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-164s1c1
Sequence:CCGGCCTCAATTGCAAACTTGCCAACTCGAGTTGGCAAGTTTGCAATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012404
ANP32D MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member D
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-108s1c1
Sequence:CCGGCCTCACAGATGAATTTGAAGACTCGAGTCTTCAAATTCATCTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-84s1c1
Sequence:CCGGGTCAAATGAAGGCAAATTGGACTCGAGTCCAATTTGCCTTCATTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-201s1c1
Sequence:CCGGGAAGCTTGAACTAAGCAGTAACTCGAGTTACTGCTTAGTTCAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-165s1c1
Sequence:CCGGCTCAATTGCAAACTTGCCAAACTCGAGTTTGGCAAGTTTGCAATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-236s1c1
Sequence:CCGGGCCTAGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-103s1c1
Sequence:CCGGGAAGGCCTCACAGATGAATTTCTCGAGAAATTCATCTGTGAGGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-146s1c1
Sequence:CCGGCAATCAACATAGGCCTCACCTCTCGAGAGGTGAGGCCTATGTTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-69s1c1
Sequence:CCGGCCTGGACAACAGTCAGTCAAACTCGAGTTTGACTGACTGTTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012404.2-96s1c1
Sequence:CCGGCAAATTGGAAGGCCTCACAGACTCGAGTCTGTGAGGCCTTCCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-159s1c1
Sequence:CCGGCCTCACCTCAATTGCAAACTTCTCGAGAAGTTTGCAATTGAGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012404.2-164s1c1
Sequence:CCGGCCTCAATTGCAAACTTGCCAACTCGAGTTGGCAAGTTTGCAATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)