EMAIL THIS PAGE TO A FRIEND

ANP32E

acidic (leucine-rich) nuclear phosphoprotein 32 family, member E

117 Gene Product Result for
Synonyms: LANP-L LANPL
Gene ID:
Mouse(66471) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Rat(361999) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Zebrafish(406562) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
chicken(426109) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
domestic cat(101082331) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
cow(507203) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
dog(475834) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
naked mole-rat(101715730) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
domestic guinea pig(100720019) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
sheep(101102602) acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46349 Anti-ANP32E antibody produced in rabbit affinity isolated antibody canine, rabbit, bovine, human, zebrafish, horse, rat, guinea pig, mouse
immunohistochemistry, western blot pricing
SAB2900347 Anti-ANP32E antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB2100124 Anti-ANP32E antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, horse, human, guinea pig, zebrafish, bovine, canine
western blot pricing
GW21207 Anti-LANPL antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
PRS3147 Anti-PHAP III antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030920 Rosetta Predictions human pricing
NM_001013200 Rosetta Predictions rat pricing
NM_023210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171200 predicted 1295
2 SASI_Hs01_00171201 predicted 1354
3 SASI_Hs01_00171202 predicted 1345
4 SASI_Hs01_00171203 predicted 1355
5 SASI_Hs01_00171204 predicted 578
6 SASI_Hs01_00171205 predicted 1296
7 SASI_Hs01_00171206 predicted 506
8 SASI_Hs01_00171207 predicted 764
9 SASI_Hs01_00171208 predicted 591
10 SASI_Hs01_00171209 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094161 predicted 463
2 SASI_Rn01_00094162 predicted 411
3 SASI_Rn01_00094163 predicted 388
4 SASI_Rn01_00094165 predicted 372
5 SASI_Rn01_00094166 predicted 414
6 SASI_Rn01_00094167 predicted 367
7 SASI_Rn01_00094168 predicted 474
8 SASI_Rn02_00200973 predicted 464
9 SASI_Rn02_00200974 predicted 315
10 SASI_Rn02_00200975 predicted 1047
11 SASI_Rn01_00094159 predicted 1080
12 SASI_Rn01_00094160 predicted 522
13 SASI_Rn01_00094164 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029230 predicted 509
2 SASI_Mm01_00029231 predicted 506
3 SASI_Mm01_00029232 predicted 565
4 SASI_Mm01_00029233 predicted 558
5 SASI_Mm01_00029234 predicted 681
6 SASI_Mm01_00029235 predicted 686
7 SASI_Mm01_00029236 predicted 378
8 SASI_Mm01_00029237 predicted 654
9 SASI_Mm01_00029238 predicted 575
10 SASI_Mm01_00029239 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030920
VALIDATED
ANP32E MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-1674s1c1
Sequence:CCGGGCAGAATAGTAAAGGTTCTATCTCGAGATAGAACCTTTACTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-982s1c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-767s1c1
Sequence:CCGGGATGGATTTGATCAGGAGGATCTCGAGATCCTCCTGATCAAATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-513s1c1
Sequence:CCGGCCAGCTTAAATAAACTTCGAACTCGAGTTCGAAGTTTATTTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-474s1c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-543s21c1
Sequence:CCGGCCCGGCTTCCCAGCTTAAATACTCGAGTATTTAAGCTGGGAAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-513s21c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1021s21c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1339s21c1
Sequence:CCGGCTAGTCTGTTAATGATCATATCTCGAGATATGATCATTAACAGACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030920
VALIDATED
ANP32E MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-1674s1c1
Sequence:CCGGGCAGAATAGTAAAGGTTCTATCTCGAGATAGAACCTTTACTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-982s1c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-767s1c1
Sequence:CCGGGATGGATTTGATCAGGAGGATCTCGAGATCCTCCTGATCAAATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-513s1c1
Sequence:CCGGCCAGCTTAAATAAACTTCGAACTCGAGTTCGAAGTTTATTTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-474s1c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-543s21c1
Sequence:CCGGCCCGGCTTCCCAGCTTAAATACTCGAGTATTTAAGCTGGGAAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-513s21c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1021s21c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1339s21c1
Sequence:CCGGCTAGTCTGTTAATGATCATATCTCGAGATATGATCATTAACAGACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030920
VALIDATED
ANP32E MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-1674s1c1
Sequence:CCGGGCAGAATAGTAAAGGTTCTATCTCGAGATAGAACCTTTACTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-982s1c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-767s1c1
Sequence:CCGGGATGGATTTGATCAGGAGGATCTCGAGATCCTCCTGATCAAATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030920.2-513s1c1
Sequence:CCGGCCAGCTTAAATAAACTTCGAACTCGAGTTCGAAGTTTATTTAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030920.2-474s1c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-543s21c1
Sequence:CCGGCCCGGCTTCCCAGCTTAAATACTCGAGTATTTAAGCTGGGAAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-513s21c1
Sequence:CCGGGTATGGCTAATGTGGAACTAACTCGAGTTAGTTCCACATTAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1021s21c1
Sequence:CCGGCCTCTCATACTTAATGAAAGACTCGAGTCTTTCATTAAGTATGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030920.3-1339s21c1
Sequence:CCGGCTAGTCTGTTAATGATCATATCTCGAGATATGATCATTAACAGACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023210
VALIDATED
ANP32E MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-1133s1c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-379s1c1
Sequence:CCGGCGATAATTGCTTGTGTGTCAACTCGAGTTGACACACAAGCAATTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-569s1c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-511s1c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-579s1c1
Sequence:CCGGCCTACCTCAATCTGAGTGGAACTCGAGTTCCACTCAGATTGAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-365s21c1
Sequence:CCGGCAGAGTTAGTCCTCGATAATTCTCGAGAATTATCGAGGACTAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-568s21c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-510s21c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-1132s21c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-941s21c1
Sequence:CCGGACTTAATGAAAGACGAAATTCCTCGAGGAATTTCGTCTTTCATTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023210
VALIDATED
ANP32E MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-1133s1c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-379s1c1
Sequence:CCGGCGATAATTGCTTGTGTGTCAACTCGAGTTGACACACAAGCAATTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-569s1c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-511s1c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-579s1c1
Sequence:CCGGCCTACCTCAATCTGAGTGGAACTCGAGTTCCACTCAGATTGAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-365s21c1
Sequence:CCGGCAGAGTTAGTCCTCGATAATTCTCGAGAATTATCGAGGACTAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-568s21c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-510s21c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-1132s21c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-941s21c1
Sequence:CCGGACTTAATGAAAGACGAAATTCCTCGAGGAATTTCGTCTTTCATTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023210
VALIDATED
ANP32E MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member E
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-1133s1c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-379s1c1
Sequence:CCGGCGATAATTGCTTGTGTGTCAACTCGAGTTGACACACAAGCAATTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023210.2-569s1c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-511s1c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023210.2-579s1c1
Sequence:CCGGCCTACCTCAATCTGAGTGGAACTCGAGTTCCACTCAGATTGAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-365s21c1
Sequence:CCGGCAGAGTTAGTCCTCGATAATTCTCGAGAATTATCGAGGACTAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-568s21c1
Sequence:CCGGCCAAATCTTACCTACCTCAATCTCGAGATTGAGGTAGGTAAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-510s21c1
Sequence:CCGGGTTGGAACTTAGTGACAATATCTCGAGATATTGTCACTAAGTTCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-1132s21c1
Sequence:CCGGGCGATCACATTGTCTTTGTTTCTCGAGAAACAAAGACAATGTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023210.3-941s21c1
Sequence:CCGGACTTAATGAAAGACGAAATTCCTCGAGGAATTTCGTCTTTCATTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)