EMAIL THIS PAGE TO A FRIEND

ANPEP

alanyl (membrane) aminopeptidase

Synonyms: APN CD13 GP150 LAP1 P150 PEPN
UniProtKB ID: P15144, Q16728, Q6GT90, Q8IUK3, Q8IVH3, Q9UCE0
Gene ID:
Human(290) Summary: Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
Mouse(16790) alanyl (membrane) aminopeptidase
Rat(81641) alanyl (membrane) aminopeptidase
chicken(395667) alanyl (membrane) aminopeptidase
domestic cat(493785) alanyl (membrane) aminopeptidase
Horse(100050397) alanyl (membrane) aminopeptidase
cow(404191) alanyl (membrane) aminopeptidase
dog(403913) alanyl (membrane) aminopeptidase
sheep(101104860) alanyl (membrane) aminopeptidase
Domestic Rabbit(100009167) alanyl (membrane) aminopeptidase
domestic guinea pig(100727522) alanyl (membrane) aminopeptidase
naked mole-rat(101706035) alanyl (membrane) aminopeptidase
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400012 Anti-ANPEP antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA004625 Anti-ANPEP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5500037 Anti-CD13 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP182, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB5500038 Anti-CD13 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP187, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB1402689 Monoclonal Anti-ANPEP, (C-terminal) antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB4700001 Monoclonal Anti-CD13 antibody produced in mouse clone WM15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, immunohistochemistry, immunoprecipitation pricing
SAB4700002 Monoclonal Anti-CD13-APC antibody produced in mouse clone WM15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700003 Monoclonal Anti-CD13-FITC antibody produced in mouse clone WM15, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700004 Monoclonal Anti-CD13-PE antibody produced in mouse clone WM15, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A6671 Actinonin human pricing
F2003 Flavone human, mouse, rat pricing
482609 N-[(2S,3R)-3-Amino-2-hydroxy-4-phenylbutyryl]-L-leucine 97% human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0907 AQUA Peptide AQIIHDSFNLASA[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001150 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001150 Rosetta Predictions human pricing
NM_031012 Rosetta Predictions rat pricing
NM_008486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061291 predicted 973
2 SASI_Hs01_00061292 predicted 2168
3 SASI_Hs01_00061293 predicted 2392
4 SASI_Hs01_00061294 predicted 847
5 SASI_Hs02_00331248 predicted 1499
6 SASI_Hs01_00061295 predicted 1231
7 SASI_Hs01_00061296 predicted 2889
8 SASI_Hs01_00061297 predicted 1166
9 SASI_Hs01_00061299 predicted 1311
10 SASI_Hs01_00061300 predicted 2877
11 SASI_Hs01_00061298 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121902 predicted 1870
2 SASI_Rn01_00121905 predicted 1769
3 SASI_Rn01_00121906 predicted 1990
4 SASI_Rn01_00121907 predicted 853
5 SASI_Rn01_00121908 predicted 1846
6 SASI_Rn01_00121909 predicted 2610
7 SASI_Rn02_00264202 predicted 368
8 SASI_Rn01_00121910 predicted 2117
9 SASI_Rn01_00121911 predicted 228
10 SASI_Rn02_00264203 predicted 220
11 SASI_Rn01_00121903 predicted 700
12 SASI_Rn01_00121904 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037714 predicted 413
2 SASI_Mm01_00037715 predicted 2563
3 SASI_Mm01_00037716 predicted 678
4 SASI_Mm02_00314011 predicted 598
5 SASI_Mm01_00037718 predicted 2958
6 SASI_Mm01_00037719 predicted 1546
7 SASI_Mm01_00037720 predicted 247
8 SASI_Mm01_00037721 predicted 234
9 SASI_Mm01_00037722 predicted 961
10 SASI_Mm01_00037723 predicted 870
11 SASI_Mm01_00037717 predicted 1517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001150
ANPEP MISSION shRNA Bacterial Glycerol Stock
alanyl (membrane) aminopeptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-3012s21c1
Sequence:CCGGGACGATTCTCCACCGAGTATGCTCGAGCATACTCGGTGGAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2886s21c1
Sequence:CCGGGCATTACCAACAACGTCATTGCTCGAGCAATGACGTTGTTGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2538s21c1
Sequence:CCGGACCAGTACAGCGAGGTTAATGCTCGAGCATTAACCTCGCTGTACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2303s1c1
Sequence:CCGGCCCTCTTCATTCACTTCAGAACTCGAGTTCTGAAGTGAATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1989s1c1
Sequence:CCGGCCTCAATGTGACGGGCTATTACTCGAGTAATAGCCCGTCACATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2223s1c1
Sequence:CCGGCCTGAGCTACTTCAAGCTCATCTCGAGATGAGCTTGAAGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-486s1c1
Sequence:CCGGCCACAGCAAGAAGCTCAACTACTCGAGTAGTTGAGCTTCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1315s1c1
Sequence:CCGGGTGACCATAGAGTGGTGGAATCTCGAGATTCCACCACTCTATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001150
ANPEP MISSION shRNA shRNA Plasmid DNA
alanyl (membrane) aminopeptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-3012s21c1
Sequence:CCGGGACGATTCTCCACCGAGTATGCTCGAGCATACTCGGTGGAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2886s21c1
Sequence:CCGGGCATTACCAACAACGTCATTGCTCGAGCAATGACGTTGTTGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2538s21c1
Sequence:CCGGACCAGTACAGCGAGGTTAATGCTCGAGCATTAACCTCGCTGTACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2303s1c1
Sequence:CCGGCCCTCTTCATTCACTTCAGAACTCGAGTTCTGAAGTGAATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1989s1c1
Sequence:CCGGCCTCAATGTGACGGGCTATTACTCGAGTAATAGCCCGTCACATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2223s1c1
Sequence:CCGGCCTGAGCTACTTCAAGCTCATCTCGAGATGAGCTTGAAGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-486s1c1
Sequence:CCGGCCACAGCAAGAAGCTCAACTACTCGAGTAGTTGAGCTTCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1315s1c1
Sequence:CCGGGTGACCATAGAGTGGTGGAATCTCGAGATTCCACCACTCTATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001150
ANPEP MISSION shRNA Lentiviral Transduction Particles
alanyl (membrane) aminopeptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-3012s21c1
Sequence:CCGGGACGATTCTCCACCGAGTATGCTCGAGCATACTCGGTGGAGAATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2886s21c1
Sequence:CCGGGCATTACCAACAACGTCATTGCTCGAGCAATGACGTTGTTGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001150.2-2538s21c1
Sequence:CCGGACCAGTACAGCGAGGTTAATGCTCGAGCATTAACCTCGCTGTACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2303s1c1
Sequence:CCGGCCCTCTTCATTCACTTCAGAACTCGAGTTCTGAAGTGAATGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1989s1c1
Sequence:CCGGCCTCAATGTGACGGGCTATTACTCGAGTAATAGCCCGTCACATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-2223s1c1
Sequence:CCGGCCTGAGCTACTTCAAGCTCATCTCGAGATGAGCTTGAAGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-486s1c1
Sequence:CCGGCCACAGCAAGAAGCTCAACTACTCGAGTAGTTGAGCTTCTTGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001150.1-1315s1c1
Sequence:CCGGGTGACCATAGAGTGGTGGAATCTCGAGATTCCACCACTCTATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008486
ANPEP MISSION shRNA Bacterial Glycerol Stock
alanyl (membrane) aminopeptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-256s1c1
Sequence:CCGGCGCTTGCCTAAGACTCTTATACTCGAGTATAAGAGTCTTAGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1920s1c1
Sequence:CCGGCCTGGTTAACTATGATGAGAACTCGAGTTCTCATCATAGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-2407s1c1
Sequence:CCGGCGGTCTACTGTCTACTGCAATCTCGAGATTGCAGTAGACAGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1977s1c1
Sequence:CCGGCCTTTCTGTTATCCCTGTCATCTCGAGATGACAGGGATAACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-133s1c1
Sequence:CCGGGCTCAGGAGAAGAATAGGAATCTCGAGATTCCTATTCTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008486
ANPEP MISSION shRNA shRNA Plasmid DNA
alanyl (membrane) aminopeptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-256s1c1
Sequence:CCGGCGCTTGCCTAAGACTCTTATACTCGAGTATAAGAGTCTTAGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1920s1c1
Sequence:CCGGCCTGGTTAACTATGATGAGAACTCGAGTTCTCATCATAGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-2407s1c1
Sequence:CCGGCGGTCTACTGTCTACTGCAATCTCGAGATTGCAGTAGACAGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1977s1c1
Sequence:CCGGCCTTTCTGTTATCCCTGTCATCTCGAGATGACAGGGATAACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-133s1c1
Sequence:CCGGGCTCAGGAGAAGAATAGGAATCTCGAGATTCCTATTCTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008486
ANPEP MISSION shRNA Lentiviral Transduction Particles
alanyl (membrane) aminopeptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-256s1c1
Sequence:CCGGCGCTTGCCTAAGACTCTTATACTCGAGTATAAGAGTCTTAGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1920s1c1
Sequence:CCGGCCTGGTTAACTATGATGAGAACTCGAGTTCTCATCATAGTTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-2407s1c1
Sequence:CCGGCGGTCTACTGTCTACTGCAATCTCGAGATTGCAGTAGACAGTAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-1977s1c1
Sequence:CCGGCCTTTCTGTTATCCCTGTCATCTCGAGATGACAGGGATAACAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008486.1-133s1c1
Sequence:CCGGGCTCAGGAGAAGAATAGGAATCTCGAGATTCCTATTCTTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks