EMAIL THIS PAGE TO A FRIEND

ANTXR1

anthrax toxin receptor 1

224 Gene Product Result for
Synonyms: ATR GAPO TEM8
UniProtKB ID: Q9H6X2, A8K7U8, Q4ZFV6, Q53QD8, Q96P02, Q9NVP3
Gene ID:
Human(84168) Summary: This gene encodes a type I transmembrane protein and is a tumor-specific endothelial marker that has been implicated in colorectal cancer. The encoded protein has been shown to also be a docking protein or receptor for Bacillus anthracis toxin, the causative agent of the disease, anthrax. The binding of the protective antigen (PA) component, of the tripartite anthrax toxin, to this receptor protein mediates delivery of toxin components to the cytosol of cells. Once inside the cell, the other two components of anthrax toxin, edema factor (EF) and lethal factor (LF) disrupt normal cellular processes. Three alternatively spliced variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008]
Mouse(69538) anthrax toxin receptor 1
Rat(362393) anthrax toxin receptor 1
chicken(428199) anthrax toxin receptor 1
Horse(100061334) anthrax toxin receptor 1
cow(616010) anthrax toxin receptor 1
domestic cat(101092930) anthrax toxin receptor 1
dog(612601) anthrax toxin receptor 1
naked mole-rat(101701494) anthrax toxin receptor 1
domestic guinea pig(100728514) anthrax toxin receptor 1
sheep(101108204) anthrax toxin receptor 1
Domestic Rabbit(100357637) anthrax toxin receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103003 Anti-ANTXR1 (126-140) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300425 Anti-ANTXR1 (Y382) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2100125 Anti-ANTXR1 antibody produced in rabbit affinity isolated antibody rat, human, horse, guinea pig, rabbit, mouse, bovine
western blot pricing
HPA052046 Anti-ANTXR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
PRS3117 Anti-ATR (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3119 Anti-ATR (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB1300728 Anti-Phospho-ANTXR1-pY382 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
SAB1300736 Anti-Phospho-ANTXR1-pY425 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
dot blot, ELISA pricing
SAB2501028 Anti-TEM8/Anthrax Toxin Receptor 1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018153 Rosetta Predictions human pricing
NM_032208 Rosetta Predictions human pricing
NM_053034 Rosetta Predictions human pricing
NM_001044249 Rosetta Predictions rat pricing
NM_054041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156841 predicted 719
2 SASI_Hs01_00156842 predicted 564
3 SASI_Hs01_00156843 predicted 316
4 SASI_Hs01_00156844 predicted 399
5 SASI_Hs01_00156846 predicted 490
6 SASI_Hs01_00156847 predicted 645
7 SASI_Hs01_00156848 predicted 646
8 SASI_Hs01_00156849 predicted 297
9 SASI_Hs01_00156850 predicted 488
10 SASI_Hs02_00351388 predicted 405
11 SASI_Hs01_00156845 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212993 predicted 720
2 SASI_Hs01_00212994 predicted 563
3 SASI_Hs01_00212995 predicted 318
4 SASI_Hs01_00212996 predicted 395
5 SASI_Hs01_00212998 predicted 492
6 SASI_Hs01_00212999 predicted 646
7 SASI_Hs01_00213000 predicted 647
8 SASI_Hs01_00213001 predicted 294
9 SASI_Hs01_00213002 predicted 482
10 SASI_Hs02_00359507 predicted 405
11 SASI_Hs01_00212997 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049894 predicted 721
2 SASI_Hs01_00049895 predicted 571
3 SASI_Hs01_00049896 predicted 311
4 SASI_Hs01_00049897 predicted 397
5 SASI_Hs01_00049899 predicted 494
6 SASI_Hs01_00049900 predicted 643
7 SASI_Hs01_00049901 predicted 641
8 SASI_Hs01_00049902 predicted 297
9 SASI_Hs01_00049903 predicted 487
10 SASI_Hs02_00361849 predicted 400
11 SASI_Hs01_00049898 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205217 predicted 1036
2 SASI_Rn02_00205218 predicted 557
3 SASI_Rn02_00205219 predicted 608
4 SASI_Rn02_00205220 predicted 809
5 SASI_Rn02_00205221 predicted 1121
6 SASI_Rn02_00205222 predicted 1110
7 SASI_Rn02_00205223 predicted 960
8 SASI_Rn02_00205224 predicted 1496
9 SASI_Rn02_00205225 predicted 1630
10 SASI_Rn02_00205226 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082528 predicted 1589
2 SASI_Mm01_00082529 predicted 674
3 SASI_Mm01_00082530 predicted 676
4 SASI_Mm01_00082531 predicted 549
5 SASI_Mm01_00082532 predicted 1183
6 SASI_Mm01_00082533 predicted 1024
7 SASI_Mm01_00082534 predicted 1043
8 SASI_Mm01_00082535 predicted 970
9 SASI_Mm01_00082536 predicted 497
10 SASI_Mm01_00082537 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018153
VALIDATED
ANTXR1 MISSION shRNA Bacterial Glycerol Stock
anthrax toxin receptor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-404s1c1
Sequence:CCGGCCGAGGAACAACCTTAATGAACTCGAGTTCATTAAGGTTGTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018153.2-939s1c1
Sequence:CCGGACACTCAATGAGAAGCCCTTTCTCGAGAAAGGGCTTCTCATTGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-308s1c1
Sequence:CCGGGCTGCACCACTGGAATGAAATCTCGAGATTTCATTCCAGTGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-368s1c1
Sequence:CCGGCCCACAGTTGAGAATGTCCTTCTCGAGAAGGACATTCTCAACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-768s1c1
Sequence:CCGGCAAGGCATCATCCACTCAATTCTCGAGAATTGAGTGGATGATGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1006s21c1
Sequence:CCGGAGAAGTCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGACTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1123s21c1
Sequence:CCGGTCTGCAGCTTCAAGATCAATGCTCGAGCATTGATCTTGAAGCTGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018153
VALIDATED
ANTXR1 MISSION shRNA shRNA Plasmid DNA
anthrax toxin receptor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-404s1c1
Sequence:CCGGCCGAGGAACAACCTTAATGAACTCGAGTTCATTAAGGTTGTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018153.2-939s1c1
Sequence:CCGGACACTCAATGAGAAGCCCTTTCTCGAGAAAGGGCTTCTCATTGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-308s1c1
Sequence:CCGGGCTGCACCACTGGAATGAAATCTCGAGATTTCATTCCAGTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-368s1c1
Sequence:CCGGCCCACAGTTGAGAATGTCCTTCTCGAGAAGGACATTCTCAACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-768s1c1
Sequence:CCGGCAAGGCATCATCCACTCAATTCTCGAGAATTGAGTGGATGATGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1006s21c1
Sequence:CCGGAGAAGTCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGACTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1123s21c1
Sequence:CCGGTCTGCAGCTTCAAGATCAATGCTCGAGCATTGATCTTGAAGCTGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018153
VALIDATED
ANTXR1 MISSION shRNA Lentiviral Transduction Particles
anthrax toxin receptor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-404s1c1
Sequence:CCGGCCGAGGAACAACCTTAATGAACTCGAGTTCATTAAGGTTGTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018153.2-939s1c1
Sequence:CCGGACACTCAATGAGAAGCCCTTTCTCGAGAAAGGGCTTCTCATTGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-308s1c1
Sequence:CCGGGCTGCACCACTGGAATGAAATCTCGAGATTTCATTCCAGTGGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-368s1c1
Sequence:CCGGCCCACAGTTGAGAATGTCCTTCTCGAGAAGGACATTCTCAACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018153.2-768s1c1
Sequence:CCGGCAAGGCATCATCCACTCAATTCTCGAGAATTGAGTGGATGATGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1006s21c1
Sequence:CCGGAGAAGTCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGACTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018153.3-1123s21c1
Sequence:CCGGTCTGCAGCTTCAAGATCAATGCTCGAGCATTGATCTTGAAGCTGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054041
ANTXR1 MISSION shRNA Bacterial Glycerol Stock
anthrax toxin receptor 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1394s1c1
Sequence:CCGGCCACAGTAGATGCCTCTTATTCTCGAGAATAAGAGGCATCTACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-2905s1c1
Sequence:CCGGGCTCACAAGTATTACCAGTTACTCGAGTAACTGGTAATACTTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-4685s1c1
Sequence:CCGGGCTACCATAAAGAAGTGGAAACTCGAGTTTCCACTTCTTTATGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1365s1c1
Sequence:CCGGCGATGATGGTTTGCCAAAGAACTCGAGTTCTTTGGCAAACCATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-646s1c1
Sequence:CCGGGCCAGTGAGCAGATTTACTATCTCGAGATAGTAAATCTGCTCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-799s1c1
Sequence:CCGGGTTGGCGTGAAGGATTTCAATCTCGAGATTGAAATCCTTCACGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-905s21c1
Sequence:CCGGACAGTAAGGACCACGTGTTTCCTCGAGGAAACACGTGGTCCTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054041.2-2117s21c1
Sequence:CCGGCCTGATGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-977s21c1
Sequence:CCGGAGAAATCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.2-594s1c1
Sequence:CCGGGACAACTTTAATGAAACTAACCTCGAGGTTAGTTTCATTAAAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1456s21c1
Sequence:CCGGACAGTAGATGCCTCTTATTATCTCGAGATAATAAGAGGCATCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1112s21c1
Sequence:CCGGATGACTCAGTCACGCTCAATGCTCGAGCATTGAGCGTGACTGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054041
ANTXR1 MISSION shRNA shRNA Plasmid DNA
anthrax toxin receptor 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1394s1c1
Sequence:CCGGCCACAGTAGATGCCTCTTATTCTCGAGAATAAGAGGCATCTACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-2905s1c1
Sequence:CCGGGCTCACAAGTATTACCAGTTACTCGAGTAACTGGTAATACTTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-4685s1c1
Sequence:CCGGGCTACCATAAAGAAGTGGAAACTCGAGTTTCCACTTCTTTATGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1365s1c1
Sequence:CCGGCGATGATGGTTTGCCAAAGAACTCGAGTTCTTTGGCAAACCATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-646s1c1
Sequence:CCGGGCCAGTGAGCAGATTTACTATCTCGAGATAGTAAATCTGCTCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-799s1c1
Sequence:CCGGGTTGGCGTGAAGGATTTCAATCTCGAGATTGAAATCCTTCACGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-905s21c1
Sequence:CCGGACAGTAAGGACCACGTGTTTCCTCGAGGAAACACGTGGTCCTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054041.2-2117s21c1
Sequence:CCGGCCTGATGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-977s21c1
Sequence:CCGGAGAAATCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.2-594s1c1
Sequence:CCGGGACAACTTTAATGAAACTAACCTCGAGGTTAGTTTCATTAAAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1456s21c1
Sequence:CCGGACAGTAGATGCCTCTTATTATCTCGAGATAATAAGAGGCATCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1112s21c1
Sequence:CCGGATGACTCAGTCACGCTCAATGCTCGAGCATTGAGCGTGACTGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054041
ANTXR1 MISSION shRNA Lentiviral Transduction Particles
anthrax toxin receptor 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1394s1c1
Sequence:CCGGCCACAGTAGATGCCTCTTATTCTCGAGAATAAGAGGCATCTACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-2905s1c1
Sequence:CCGGGCTCACAAGTATTACCAGTTACTCGAGTAACTGGTAATACTTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054041.1-4685s1c1
Sequence:CCGGGCTACCATAAAGAAGTGGAAACTCGAGTTTCCACTTCTTTATGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054041.1-1365s1c1
Sequence:CCGGCGATGATGGTTTGCCAAAGAACTCGAGTTCTTTGGCAAACCATCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-646s1c1
Sequence:CCGGGCCAGTGAGCAGATTTACTATCTCGAGATAGTAAATCTGCTCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.1-799s1c1
Sequence:CCGGGTTGGCGTGAAGGATTTCAATCTCGAGATTGAAATCCTTCACGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-905s21c1
Sequence:CCGGACAGTAAGGACCACGTGTTTCCTCGAGGAAACACGTGGTCCTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336488    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054041.2-2117s21c1
Sequence:CCGGCCTGATGTTTGCACGATTTAACTCGAGTTAAATCGTGCAAACATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-977s21c1
Sequence:CCGGAGAAATCCTGCATCGAAATTCCTCGAGGAATTTCGATGCAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054041.2-594s1c1
Sequence:CCGGGACAACTTTAATGAAACTAACCTCGAGGTTAGTTTCATTAAAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1456s21c1
Sequence:CCGGACAGTAGATGCCTCTTATTATCTCGAGATAATAAGAGGCATCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054041.2-1112s21c1
Sequence:CCGGATGACTCAGTCACGCTCAATGCTCGAGCATTGAGCGTGACTGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)