EMAIL THIS PAGE TO A FRIEND

ANTXR2

anthrax toxin receptor 2

136 Gene Product Result for
Synonyms: CMG-2 CMG2 HFS ISH JHF
Gene ID:
Human(118429) Summary: This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(71914) anthrax toxin receptor 2
Rat(305633) anthrax toxin receptor 2
chicken(422580) anthrax toxin receptor 2
cow(510080) anthrax toxin receptor 2
Horse(100051770) anthrax toxin receptor 2
domestic cat(101094174) anthrax toxin receptor 2
dog(487821) anthrax toxin receptor 2
sheep(101113070) anthrax toxin receptor 2
Domestic Rabbit(100356899) anthrax toxin receptor 2
domestic guinea pig(100722386) anthrax toxin receptor 2
naked mole-rat(101702182) anthrax toxin receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1378 Human CMG-2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058172 Rosetta Predictions human pricing
XM_001069109 Rosetta Predictions rat pricing
XM_223745 Rosetta Predictions rat pricing
NM_133738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239862 predicted 1609
2 SASI_Hs01_00239863 predicted 1945
3 SASI_Hs01_00239864 predicted 757
4 SASI_Hs01_00239865 predicted 851
5 SASI_Hs02_00362072 predicted 867
6 SASI_Hs01_00239867 predicted 1282
7 SASI_Hs01_00239868 predicted 641
8 SASI_Hs01_00239869 predicted 880
9 SASI_Hs01_00239871 predicted 1127
10 SASI_Hs02_00362073 predicted 913
11 SASI_Hs01_00239866 predicted 1205
12 SASI_Hs01_00239870 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326952 predicted 474
2 SASI_Rn02_00326953 predicted 870
3 SASI_Rn02_00326954 predicted 1573
4 SASI_Rn02_00326955 predicted 1067
5 SASI_Rn02_00326956 predicted 465
6 SASI_Rn02_00326957 predicted 1121
7 SASI_Rn02_00326958 predicted 591
8 SASI_Rn02_00326959 predicted 979
9 SASI_Rn02_00326960 predicted 1125
10 SASI_Rn02_00326961 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381650 predicted 730
2 SASI_Rn02_00381651 predicted 1170
3 SASI_Rn02_00381652 predicted 1121
4 SASI_Rn02_00381653 predicted 268
5 SASI_Rn02_00381654 predicted 276
6 SASI_Rn02_00381655 predicted 527
7 SASI_Rn02_00381656 predicted 318
8 SASI_Rn02_00381657 predicted 1149
9 SASI_Rn02_00381658 predicted 303
10 SASI_Rn02_00381659 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174711 predicted 718
2 SASI_Mm01_00174712 predicted 645
3 SASI_Mm01_00174713 predicted 1732
4 SASI_Mm01_00174714 predicted 1282
5 SASI_Mm01_00174715 predicted 1042
6 SASI_Mm01_00174716 predicted 1170
7 SASI_Mm01_00174717 predicted 741
8 SASI_Mm01_00174718 predicted 582
9 SASI_Mm01_00174719 predicted 763
10 SASI_Mm01_00174720 predicted 1031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058172
ANTXR2 MISSION shRNA Bacterial Glycerol Stock
anthrax toxin receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1717s21c1
Sequence:CCGGGATCGCAGCCATCATTGTTATCTCGAGATAACAATGATGGCTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1668s21c1
Sequence:CCGGCTGTCATTTCAGGATCATTAACTCGAGTTAATGATCCTGAAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-511s1c1
Sequence:CCGGGAGGAATTTCAGATTGTCTTACTCGAGTAAGACAATCTGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-652s1c1
Sequence:CCGGCCTGCACCTATCCTGAATAAACTCGAGTTTATTCAGGATAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-578s1c1
Sequence:CCGGGCACTTACACTGTAAATGAAACTCGAGTTTCATTTACAGTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-382s1c1
Sequence:CCGGGCTGATTCCAAGGAGCAAGTTCTCGAGAACTTGCTCCTTGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-301s1c1
Sequence:CCGGGCAAAGATATCCAGGTCACTTCTCGAGAAGTGACCTGGATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058172
ANTXR2 MISSION shRNA shRNA Plasmid DNA
anthrax toxin receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1717s21c1
Sequence:CCGGGATCGCAGCCATCATTGTTATCTCGAGATAACAATGATGGCTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1668s21c1
Sequence:CCGGCTGTCATTTCAGGATCATTAACTCGAGTTAATGATCCTGAAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-511s1c1
Sequence:CCGGGAGGAATTTCAGATTGTCTTACTCGAGTAAGACAATCTGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-652s1c1
Sequence:CCGGCCTGCACCTATCCTGAATAAACTCGAGTTTATTCAGGATAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-578s1c1
Sequence:CCGGGCACTTACACTGTAAATGAAACTCGAGTTTCATTTACAGTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-382s1c1
Sequence:CCGGGCTGATTCCAAGGAGCAAGTTCTCGAGAACTTGCTCCTTGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-301s1c1
Sequence:CCGGGCAAAGATATCCAGGTCACTTCTCGAGAAGTGACCTGGATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058172
ANTXR2 MISSION shRNA Lentiviral Transduction Particles
anthrax toxin receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1717s21c1
Sequence:CCGGGATCGCAGCCATCATTGTTATCTCGAGATAACAATGATGGCTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058172.5-1668s21c1
Sequence:CCGGCTGTCATTTCAGGATCATTAACTCGAGTTAATGATCCTGAAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-511s1c1
Sequence:CCGGGAGGAATTTCAGATTGTCTTACTCGAGTAAGACAATCTGAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-652s1c1
Sequence:CCGGCCTGCACCTATCCTGAATAAACTCGAGTTTATTCAGGATAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-578s1c1
Sequence:CCGGGCACTTACACTGTAAATGAAACTCGAGTTTCATTTACAGTGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-382s1c1
Sequence:CCGGGCTGATTCCAAGGAGCAAGTTCTCGAGAACTTGCTCCTTGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058172.1-301s1c1
Sequence:CCGGGCAAAGATATCCAGGTCACTTCTCGAGAAGTGACCTGGATATCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133738
VALIDATED
ANTXR2 MISSION shRNA Bacterial Glycerol Stock
anthrax toxin receptor 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1286s21c1
Sequence:CCGGTGAAGTTTCAATCAGCTATAACTCGAGTTATAGCTGATTGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-3227s21c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-669s21c1
Sequence:CCGGTCTTCCCAAGCAACCATTATTCTCGAGAATAATGGTTGCTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1287s1c1
Sequence:CCGGGAAGTTTCAATCAGCTATAATCTCGAGATTATAGCTGATTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133738.1-1880s21c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1034s21c1
Sequence:CCGGAGGCATCATCAACTCTATATTCTCGAGAATATAGAGTTGATGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-3227s1c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1063s1c1
Sequence:CCGGCATGTACTGAAATCCTGGAATCTCGAGATTCCAGGATTTCAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133738.1-830s1c1
Sequence:CCGGCTCCAGTATCATAATTGCTTTCTCGAGAAAGCAATTATGATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-576s1c1
Sequence:CCGGGTAGCAAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-1172s1c1
Sequence:CCGGCCTCTGTACATTCACTGCAAACTCGAGTTTGCAGTGAATGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133738.1-1880s1c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133738
VALIDATED
ANTXR2 MISSION shRNA shRNA Plasmid DNA
anthrax toxin receptor 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1286s21c1
Sequence:CCGGTGAAGTTTCAATCAGCTATAACTCGAGTTATAGCTGATTGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-3227s21c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-669s21c1
Sequence:CCGGTCTTCCCAAGCAACCATTATTCTCGAGAATAATGGTTGCTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1287s1c1
Sequence:CCGGGAAGTTTCAATCAGCTATAATCTCGAGATTATAGCTGATTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133738.1-1880s21c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1034s21c1
Sequence:CCGGAGGCATCATCAACTCTATATTCTCGAGAATATAGAGTTGATGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-3227s1c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1063s1c1
Sequence:CCGGCATGTACTGAAATCCTGGAATCTCGAGATTCCAGGATTTCAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133738.1-830s1c1
Sequence:CCGGCTCCAGTATCATAATTGCTTTCTCGAGAAAGCAATTATGATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-576s1c1
Sequence:CCGGGTAGCAAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-1172s1c1
Sequence:CCGGCCTCTGTACATTCACTGCAAACTCGAGTTTGCAGTGAATGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133738.1-1880s1c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133738
VALIDATED
ANTXR2 MISSION shRNA Lentiviral Transduction Particles
anthrax toxin receptor 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1286s21c1
Sequence:CCGGTGAAGTTTCAATCAGCTATAACTCGAGTTATAGCTGATTGAAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-3227s21c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-669s21c1
Sequence:CCGGTCTTCCCAAGCAACCATTATTCTCGAGAATAATGGTTGCTTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1287s1c1
Sequence:CCGGGAAGTTTCAATCAGCTATAATCTCGAGATTATAGCTGATTGAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133738.1-1880s21c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133738.1-1034s21c1
Sequence:CCGGAGGCATCATCAACTCTATATTCTCGAGAATATAGAGTTGATGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-3227s1c1
Sequence:CCGGCCGAAGGAAATAGCTCAGATACTCGAGTATCTGAGCTATTTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133738.1-1063s1c1
Sequence:CCGGCATGTACTGAAATCCTGGAATCTCGAGATTCCAGGATTTCAGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133738.1-830s1c1
Sequence:CCGGCTCCAGTATCATAATTGCTTTCTCGAGAAAGCAATTATGATACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-576s1c1
Sequence:CCGGGTAGCAAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133738.1-1172s1c1
Sequence:CCGGCCTCTGTACATTCACTGCAAACTCGAGTTTGCAGTGAATGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133738.1-1880s1c1
Sequence:CCGGCGGGAGAACAAAGAATGAGAACTCGAGTTCTCATTCTTTGTTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks