EMAIL THIS PAGE TO A FRIEND

ANTXRL

anthrax toxin receptor-like

65 Gene Product Result for
UniProtKB ID: A6NF34
Gene ID:
Mouse(239029) anthrax toxin receptor-like
Rat(364513) anthrax toxin receptor-like
chicken(423775) anthrax toxin receptor-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003601 Rosetta Predictions human pricing
XM_927027 Rosetta Predictions human pricing
XR_042164 Rosetta Predictions human pricing
XM_001059971 Rosetta Predictions rat pricing
XM_344485 Rosetta Predictions rat pricing
NM_172808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379795 predicted 770
2 SASI_Hs02_00379796 predicted 592
3 SASI_Hs02_00379797 predicted 229
4 SASI_Hs02_00379798 predicted 269
5 SASI_Hs02_00379799 predicted 436
6 SASI_Hs02_00379800 predicted 709
7 SASI_Hs02_00379801 predicted 826
8 SASI_Hs02_00379802 predicted 874
9 SASI_Hs02_00379803 predicted 814
10 SASI_Hs02_00379804 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278694 predicted 1729
2 SASI_Hs01_00278695 predicted 1496
3 SASI_Hs01_00278696 predicted 1508
4 SASI_Hs01_00278697 predicted 1726
5 SASI_Hs01_00278698 predicted 1632
6 SASI_Hs01_00278699 predicted 1498
7 SASI_Hs01_00278700 predicted 1555
8 SASI_Hs01_00278701 predicted 1559
9 SASI_Hs01_00278702 predicted 1468
10 SASI_Hs01_00278703 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533503 predicted 1049
2 SASI_Hs02_00533504 predicted 1041
3 SASI_Hs02_00533505 predicted 525
4 SASI_Hs02_00533506 predicted 574
5 SASI_Hs02_00533507 predicted 731
6 SASI_Hs02_00533508 predicted 478
7 SASI_Hs02_00533509 predicted 1105
8 SASI_Hs02_00533510 predicted 1157
9 SASI_Hs02_00533511 predicted 1099
10 SASI_Hs02_00533512 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295010 predicted 980
2 SASI_Rn02_00295011 predicted 727
3 SASI_Rn02_00295012 predicted 1449
4 SASI_Rn02_00295013 predicted 1620
5 SASI_Rn02_00295014 predicted 910
6 SASI_Rn02_00295015 predicted 1704
7 SASI_Rn02_00295016 predicted 861
8 SASI_Rn02_00295017 predicted 1648
9 SASI_Rn02_00295018 predicted 350
10 SASI_Rn02_00295019 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397151 predicted 346
2 SASI_Rn02_00397152 predicted 1457
3 SASI_Rn02_00397153 predicted 1628
4 SASI_Rn02_00397154 predicted 1698
5 SASI_Rn02_00397155 predicted 1650
6 SASI_Rn02_00397156 predicted 292
7 SASI_Rn02_00397157 predicted 278
8 SASI_Rn02_00397158 predicted 1643
9 SASI_Rn02_00397159 predicted 434
10 SASI_Rn02_00397160 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054390 predicted 967
2 SASI_Mm01_00054391 predicted 741
3 SASI_Mm01_00054392 predicted 1166
4 SASI_Mm01_00054393 predicted 1019
5 SASI_Mm01_00054394 predicted 1063
6 SASI_Mm01_00054395 predicted 636
7 SASI_Mm01_00054396 predicted 538
8 SASI_Mm01_00054397 predicted 836
9 SASI_Mm01_00054398 predicted 793
10 SASI_Mm01_00054399 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172808
ANTXRL MISSION shRNA Bacterial Glycerol Stock
anthrax toxin receptor-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-618s1c1
Sequence:CCGGCTTAAGAGCATAGTGCCTCAACTCGAGTTGAGGCACTATGCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-974s1c1
Sequence:CCGGGCCTACCTACGTTTGTGCAAACTCGAGTTTGCACAAACGTAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-503s1c1
Sequence:CCGGGAAGAAATTCACAAACCCTAACTCGAGTTAGGGTTTGTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1042s1c1
Sequence:CCGGGCAATATGAAGCAAGTCATTTCTCGAGAAATGACTTGCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1347s1c1
Sequence:CCGGCTTTGCATAAAGCCTAAGAAACTCGAGTTTCTTAGGCTTTATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172808
ANTXRL MISSION shRNA shRNA Plasmid DNA
anthrax toxin receptor-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-618s1c1
Sequence:CCGGCTTAAGAGCATAGTGCCTCAACTCGAGTTGAGGCACTATGCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-974s1c1
Sequence:CCGGGCCTACCTACGTTTGTGCAAACTCGAGTTTGCACAAACGTAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-503s1c1
Sequence:CCGGGAAGAAATTCACAAACCCTAACTCGAGTTAGGGTTTGTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1042s1c1
Sequence:CCGGGCAATATGAAGCAAGTCATTTCTCGAGAAATGACTTGCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1347s1c1
Sequence:CCGGCTTTGCATAAAGCCTAAGAAACTCGAGTTTCTTAGGCTTTATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172808
ANTXRL MISSION shRNA Lentiviral Transduction Particles
anthrax toxin receptor-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-618s1c1
Sequence:CCGGCTTAAGAGCATAGTGCCTCAACTCGAGTTGAGGCACTATGCTCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-974s1c1
Sequence:CCGGGCCTACCTACGTTTGTGCAAACTCGAGTTTGCACAAACGTAGGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-503s1c1
Sequence:CCGGGAAGAAATTCACAAACCCTAACTCGAGTTAGGGTTTGTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1042s1c1
Sequence:CCGGGCAATATGAAGCAAGTCATTTCTCGAGAAATGACTTGCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172808.1-1347s1c1
Sequence:CCGGCTTTGCATAAAGCCTAAGAAACTCGAGTTTCTTAGGCTTTATGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks