EMAIL THIS PAGE TO A FRIEND

ANXA10

annexin A10

73 Gene Product Result for
Synonyms: ANX14
UniProtKB ID: Q9UJ72, Q96IQ5, Q9UJV4
Gene ID:
Human(11199) Summary: This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(26359) annexin A10
Rat(498622) annexin A10
sheep(101122664) annexin A10
chicken(770326) annexin A10
cow(505322) annexin A10
dog(612718) annexin A10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007193 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069891 MISSION® esiRNA esiRNA human ANXA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007193 Rosetta Predictions human pricing
NM_001109110 Rosetta Predictions rat pricing
NM_011922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178347 predicted 1179
2 SASI_Hs01_00178348 predicted 323
3 SASI_Hs01_00178350 predicted 1188
4 SASI_Hs02_00343167 predicted 1144
5 SASI_Hs01_00178351 predicted 919
6 SASI_Hs02_00343168 predicted 914
7 SASI_Hs01_00178353 predicted 944
8 SASI_Hs01_00178354 predicted 469
9 SASI_Hs01_00178355 predicted 727
10 SASI_Hs02_00343169 predicted 363
11 SASI_Hs01_00178349 predicted 816
12 SASI_Hs01_00178352 predicted 385
13 SASI_Hs01_00178356 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245220 predicted 494
2 SASI_Rn02_00245221 predicted 499
3 SASI_Rn02_00245222 predicted 322
4 SASI_Rn02_00245223 predicted 253
5 SASI_Rn02_00245224 predicted 585
6 SASI_Rn02_00245225 predicted 1000
7 SASI_Rn02_00245226 predicted 373
8 SASI_Rn02_00245227 predicted 319
9 SASI_Rn02_00245228 predicted 500
10 SASI_Rn02_00245229 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321745 predicted 944
2 SASI_Mm02_00321746 predicted 244
3 SASI_Mm02_00321747 predicted 414
4 SASI_Mm02_00321748 predicted 864
5 SASI_Mm02_00321749 predicted 297
6 SASI_Mm02_00321750 predicted 863
7 SASI_Mm02_00321751 predicted 299
8 SASI_Mm02_00321752 predicted 871
9 SASI_Mm02_00321753 predicted 482
10 SASI_Mm02_00321754 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007193
VALIDATED
ANXA10 MISSION shRNA Bacterial Glycerol Stock
annexin A10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007193.3-188s21c1
Sequence:CCGGCCCAATTTCAATCCCATAATGCTCGAGCATTATGGGATTGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-477s21c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-1032s21c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007193.3-1194s21c1
Sequence:CCGGTACTGTTCATGGCACTATTAACTCGAGTTAATAGTGCCATGAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-972s1c1
Sequence:CCGGGCTGACCATAAGGAAACGATACTCGAGTATCGTTTCCTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-166s1c1
Sequence:CCGGGCTCCCAATTTCAATCCCATACTCGAGTATGGGATTGAAATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-217s1c1
Sequence:CCGGCAAGGATTTGACTGTGACAAACTCGAGTTTGTCACAGTCAAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-1013s1c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-458s1c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007193
VALIDATED
ANXA10 MISSION shRNA shRNA Plasmid DNA
annexin A10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007193.3-188s21c1
Sequence:CCGGCCCAATTTCAATCCCATAATGCTCGAGCATTATGGGATTGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-477s21c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-1032s21c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007193.3-1194s21c1
Sequence:CCGGTACTGTTCATGGCACTATTAACTCGAGTTAATAGTGCCATGAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-972s1c1
Sequence:CCGGGCTGACCATAAGGAAACGATACTCGAGTATCGTTTCCTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-166s1c1
Sequence:CCGGGCTCCCAATTTCAATCCCATACTCGAGTATGGGATTGAAATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-217s1c1
Sequence:CCGGCAAGGATTTGACTGTGACAAACTCGAGTTTGTCACAGTCAAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-1013s1c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-458s1c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007193
VALIDATED
ANXA10 MISSION shRNA Lentiviral Transduction Particles
annexin A10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_007193.3-188s21c1
Sequence:CCGGCCCAATTTCAATCCCATAATGCTCGAGCATTATGGGATTGAAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-477s21c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007193.3-1032s21c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007193.3-1194s21c1
Sequence:CCGGTACTGTTCATGGCACTATTAACTCGAGTTAATAGTGCCATGAACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-972s1c1
Sequence:CCGGGCTGACCATAAGGAAACGATACTCGAGTATCGTTTCCTTATGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-166s1c1
Sequence:CCGGGCTCCCAATTTCAATCCCATACTCGAGTATGGGATTGAAATTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-217s1c1
Sequence:CCGGCAAGGATTTGACTGTGACAAACTCGAGTTTGTCACAGTCAAATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007193.2-1013s1c1
Sequence:CCGGCCCTATTTCATGATATCAGAACTCGAGTTCTGATATCATGAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007193.2-458s1c1
Sequence:CCGGGCCTCATTGAAATACTAGCTTCTCGAGAAGCTAGTATTTCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011922
VALIDATED
ANXA10 MISSION shRNA Bacterial Glycerol Stock
annexin A10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-1104s1c1
Sequence:CCGGGCGTGCTGTATTCACACTGAACTCGAGTTCAGTGTGAATACAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011922.1-789s1c1
Sequence:CCGGGTTCGTTGTATCCAGGACAAACTCGAGTTTGTCCTGGATACAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-270s1c1
Sequence:CCGGTCAGTTCTGAAGGAACAACTTCTCGAGAAGTTGTTCCTTCAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-738s1c1
Sequence:CCGGGCCATCAATGACTGTACCGATCTCGAGATCGGTACAGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-333s1c1
Sequence:CCGGCCACCATCTTATGATGCTCATCTCGAGATGAGCATCATAAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011922
VALIDATED
ANXA10 MISSION shRNA shRNA Plasmid DNA
annexin A10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-1104s1c1
Sequence:CCGGGCGTGCTGTATTCACACTGAACTCGAGTTCAGTGTGAATACAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011922.1-789s1c1
Sequence:CCGGGTTCGTTGTATCCAGGACAAACTCGAGTTTGTCCTGGATACAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-270s1c1
Sequence:CCGGTCAGTTCTGAAGGAACAACTTCTCGAGAAGTTGTTCCTTCAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-738s1c1
Sequence:CCGGGCCATCAATGACTGTACCGATCTCGAGATCGGTACAGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-333s1c1
Sequence:CCGGCCACCATCTTATGATGCTCATCTCGAGATGAGCATCATAAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011922
VALIDATED
ANXA10 MISSION shRNA Lentiviral Transduction Particles
annexin A10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-1104s1c1
Sequence:CCGGGCGTGCTGTATTCACACTGAACTCGAGTTCAGTGTGAATACAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011922.1-789s1c1
Sequence:CCGGGTTCGTTGTATCCAGGACAAACTCGAGTTTGTCCTGGATACAACGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-270s1c1
Sequence:CCGGTCAGTTCTGAAGGAACAACTTCTCGAGAAGTTGTTCCTTCAGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-738s1c1
Sequence:CCGGGCCATCAATGACTGTACCGATCTCGAGATCGGTACAGTCATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011922.1-333s1c1
Sequence:CCGGCCACCATCTTATGATGCTCATCTCGAGATGAGCATCATAAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks