EMAIL THIS PAGE TO A FRIEND

ANXA11

annexin A11

130 Gene Product Result for
Synonyms: ANX11 CAP50
UniProtKB ID: P50995
Gene ID:
Human(311) Summary: This gene encodes a member of the annexin family, a group of calcium-dependent phospholipid-binding proteins. Annexins have unique N-terminal domains and conserved C-terminal domains, which contain the calcium-dependent phospholipid-binding sites. The encoded protein is a 56-kD antigen recognized by sera from patients with various autoimmune diseases. Several transcript variants encoding two different isoforms have been identified. [provided by RefSeq, May 2013]
Mouse(11744) annexin A11
Rat(290527) annexin A11
chicken(423637) annexin A11
cow(282142) annexin A11
Horse(100064425) annexin A11
dog(479259) annexin A11
sheep(101105975) annexin A11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001157 Rosetta Predictions human pricing
NM_145868 Rosetta Predictions human pricing
NM_145869 Rosetta Predictions human pricing
NM_001011918 Rosetta Predictions rat pricing
XM_573849 Rosetta Predictions rat pricing
NM_013469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128498 predicted 1851
2 SASI_Hs01_00128499 predicted 1728
3 SASI_Hs01_00128500 predicted 1631
4 SASI_Hs01_00128501 predicted 1138
5 SASI_Hs01_00128502 predicted 1158
6 SASI_Hs01_00128503 predicted 813
7 SASI_Hs02_00331269 predicted 1026
8 SASI_Hs01_00128506 predicted 1597
9 SASI_Hs02_00331270 predicted 976
10 SASI_Hs01_00128507 predicted 1656
11 SASI_Hs01_00128504 predicted 590
12 SASI_Hs01_00128505 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168609 predicted 1899
2 SASI_Hs01_00168610 predicted 1774
3 SASI_Hs01_00168611 predicted 1686
4 SASI_Hs01_00168612 predicted 1193
5 SASI_Hs01_00168613 predicted 1208
6 SASI_Hs01_00168614 predicted 861
7 SASI_Hs02_00365396 predicted 1074
8 SASI_Hs01_00168617 predicted 1640
9 SASI_Hs02_00365397 predicted 1024
10 SASI_Hs01_00168618 predicted 1701
11 SASI_Hs01_00168615 predicted 638
12 SASI_Hs01_00168616 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101385 predicted 2098
2 SASI_Hs01_00101386 predicted 1976
3 SASI_Hs01_00101387 predicted 1878
4 SASI_Hs01_00101388 predicted 1385
5 SASI_Hs01_00101389 predicted 1398
6 SASI_Hs01_00101390 predicted 1058
7 SASI_Hs02_00365398 predicted 1267
8 SASI_Hs01_00101393 predicted 1834
9 SASI_Hs02_00365399 predicted 1221
10 SASI_Hs01_00101394 predicted 1906
11 SASI_Hs01_00101391 predicted 833
12 SASI_Hs01_00101392 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096383 predicted 1196
2 SASI_Rn01_00096384 predicted 806
3 SASI_Rn01_00096386 predicted 1471
4 SASI_Rn01_00096387 predicted 1450
5 SASI_Rn01_00096388 predicted 1182
6 SASI_Rn01_00096389 predicted 1029
7 SASI_Rn01_00096390 predicted 1411
8 SASI_Rn01_00096391 predicted 407
9 SASI_Rn01_00096392 predicted 982
10 SASI_Rn02_00199916 predicted 1044
11 SASI_Rn01_00096385 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151210 predicted 1574
2 SASI_Rn01_00151211 predicted 1193
3 SASI_Rn01_00151212 predicted 1178
4 SASI_Rn01_00151213 predicted 1858
5 SASI_Rn01_00151214 predicted 1837
6 SASI_Rn01_00151215 predicted 1557
7 SASI_Rn01_00151216 predicted 1404
8 SASI_Rn01_00151217 predicted 1790
9 SASI_Rn01_00151218 predicted 787
10 SASI_Rn01_00151219 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086401 predicted 879
2 SASI_Mm01_00086402 predicted 774
3 SASI_Mm01_00086404 predicted 1537
4 SASI_Mm01_00086407 predicted 913
5 SASI_Mm01_00086408 predicted 591
6 SASI_Mm02_00322084 predicted 1066
7 SASI_Mm01_00086410 predicted 1493
8 SASI_Mm02_00322085 predicted 647
9 SASI_Mm02_00322086 predicted 933
10 SASI_Mm02_00322087 predicted 1018
11 SASI_Mm01_00086403 predicted 957
12 SASI_Mm01_00086405 predicted 1344
13 SASI_Mm01_00086406 predicted 706
14 SASI_Mm01_00086409 predicted 1523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001157
VALIDATED
ANXA11 MISSION shRNA Bacterial Glycerol Stock
annexin A11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1159s1c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-578s1c1
Sequence:CCGGCCCTCCAGGATGCCCTCATATCTCGAGATATGAGGGCATCCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-946s1c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1510s1c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1055s1c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001157.2-946s21c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1510s21c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1159s21c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1055s21c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001157.2-2051s21c1
Sequence:GTACCGGGGCTTCATTTCGTCATGTAATCTCGAGATTACATGACGAAATGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001157
VALIDATED
ANXA11 MISSION shRNA shRNA Plasmid DNA
annexin A11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1159s1c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-578s1c1
Sequence:CCGGCCCTCCAGGATGCCCTCATATCTCGAGATATGAGGGCATCCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-946s1c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1510s1c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1055s1c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001157.2-946s21c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1510s21c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1159s21c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1055s21c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001157.2-2051s21c1
Sequence:GTACCGGGGCTTCATTTCGTCATGTAATCTCGAGATTACATGACGAAATGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001157
VALIDATED
ANXA11 MISSION shRNA Lentiviral Transduction Particles
annexin A11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1159s1c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-578s1c1
Sequence:CCGGCCCTCCAGGATGCCCTCATATCTCGAGATATGAGGGCATCCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-946s1c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1510s1c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001157.2-1055s1c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001157.2-946s21c1
Sequence:CCGGGCAGATCCTACTTTCCTTCAACTCGAGTTGAAGGAAAGTAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1510s21c1
Sequence:CCGGCGTGGTGAAATGTCTCAAGAACTCGAGTTCTTGAGACATTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1159s21c1
Sequence:CCGGCCGAGAATTAAACAGAGCCTACTCGAGTAGGCTCTGTTTAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001157.2-1055s21c1
Sequence:CCGGCCAGTCCTCTTTGACATTTATCTCGAGATAAATGTCAAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001157.2-2051s21c1
Sequence:GTACCGGGGCTTCATTTCGTCATGTAATCTCGAGATTACATGACGAAATGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013469
ANXA11 MISSION shRNA Bacterial Glycerol Stock
annexin A11
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013469.1-2028s1c1
Sequence:CCGGGCGTATTTACTGTATCGTGTTCTCGAGAACACGATACAGTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-846s1c1
Sequence:CCGGCTATCCTTCAAGACGGCCTATCTCGAGATAGGCCGTCTTGAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1604s1c1
Sequence:CCGGCTATCGAAAGATTCTACTGAACTCGAGTTCAGTAGAATCTTTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-245s1c1
Sequence:CCGGGCTGGATAACGTAGCCAACTACTCGAGTAGTTGGCTACGTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1337s1c1
Sequence:CCGGCCGAGACATTGAGAAGAGCATCTCGAGATGCTCTTCTCAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-968s21c1
Sequence:GTACCGGGTTTGATGTCTATGAGATAAACTCGAGTTTATCTCATAGACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-921s21c1
Sequence:GTACCGGGGAAACTTTGAGAAGACTATCCTCGAGGATAGTCTTCTCAAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-262s21c1
Sequence:GTACCGGTGGATAACGTAGCCAACTATGCTCGAGCATAGTTGGCTACGTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-862s21c1
Sequence:GTACCGGTATCCTTCAAGACGGCCTATGCTCGAGCATAGGCCGTCTTGAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-349s21c1
Sequence:GTACCGGCCAACGTGCCAAATCTGTATCCTCGAGGATACAGATTTGGCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-887s21c1
Sequence:GTACCGGGGATTTGATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-486s21c1
Sequence:GTACCGGCCTCCTGGGATGCCTTCATATCTCGAGATATGAAGGCATCCCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013469
ANXA11 MISSION shRNA shRNA Plasmid DNA
annexin A11
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013469.1-2028s1c1
Sequence:CCGGGCGTATTTACTGTATCGTGTTCTCGAGAACACGATACAGTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-846s1c1
Sequence:CCGGCTATCCTTCAAGACGGCCTATCTCGAGATAGGCCGTCTTGAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1604s1c1
Sequence:CCGGCTATCGAAAGATTCTACTGAACTCGAGTTCAGTAGAATCTTTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-245s1c1
Sequence:CCGGGCTGGATAACGTAGCCAACTACTCGAGTAGTTGGCTACGTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1337s1c1
Sequence:CCGGCCGAGACATTGAGAAGAGCATCTCGAGATGCTCTTCTCAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-968s21c1
Sequence:GTACCGGGTTTGATGTCTATGAGATAAACTCGAGTTTATCTCATAGACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-921s21c1
Sequence:GTACCGGGGAAACTTTGAGAAGACTATCCTCGAGGATAGTCTTCTCAAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-262s21c1
Sequence:GTACCGGTGGATAACGTAGCCAACTATGCTCGAGCATAGTTGGCTACGTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-862s21c1
Sequence:GTACCGGTATCCTTCAAGACGGCCTATGCTCGAGCATAGGCCGTCTTGAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-349s21c1
Sequence:GTACCGGCCAACGTGCCAAATCTGTATCCTCGAGGATACAGATTTGGCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-887s21c1
Sequence:GTACCGGGGATTTGATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-486s21c1
Sequence:GTACCGGCCTCCTGGGATGCCTTCATATCTCGAGATATGAAGGCATCCCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013469
ANXA11 MISSION shRNA Lentiviral Transduction Particles
annexin A11
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013469.1-2028s1c1
Sequence:CCGGGCGTATTTACTGTATCGTGTTCTCGAGAACACGATACAGTAAATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-846s1c1
Sequence:CCGGCTATCCTTCAAGACGGCCTATCTCGAGATAGGCCGTCTTGAAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1604s1c1
Sequence:CCGGCTATCGAAAGATTCTACTGAACTCGAGTTCAGTAGAATCTTTCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-245s1c1
Sequence:CCGGGCTGGATAACGTAGCCAACTACTCGAGTAGTTGGCTACGTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013469.1-1337s1c1
Sequence:CCGGCCGAGACATTGAGAAGAGCATCTCGAGATGCTCTTCTCAATGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-968s21c1
Sequence:GTACCGGGTTTGATGTCTATGAGATAAACTCGAGTTTATCTCATAGACATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-921s21c1
Sequence:GTACCGGGGAAACTTTGAGAAGACTATCCTCGAGGATAGTCTTCTCAAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-262s21c1
Sequence:GTACCGGTGGATAACGTAGCCAACTATGCTCGAGCATAGTTGGCTACGTTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-862s21c1
Sequence:GTACCGGTATCCTTCAAGACGGCCTATGCTCGAGCATAGGCCGTCTTGAAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-349s21c1
Sequence:GTACCGGCCAACGTGCCAAATCTGTATCCTCGAGGATACAGATTTGGCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-887s21c1
Sequence:GTACCGGGGATTTGATCAAAGACCTAAACTCGAGTTTAGGTCTTTGATCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013469.2-486s21c1
Sequence:GTACCGGCCTCCTGGGATGCCTTCATATCTCGAGATATGAAGGCATCCCAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks