EMAIL THIS PAGE TO A FRIEND

ANXA13

annexin A13

98 Gene Product Result for
Synonyms: ANX13 ISA
UniProtKB ID: P27216, Q9BQR5
Gene ID:
Human(312) Summary: This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The specific function of this gene has not yet been determined; however, it is associated with the plasma membrane of undifferentiated, proliferating endothelial cells and differentiated villus enterocytes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(69787) annexin A13
Rat(362915) annexin A13
Zebrafish(81880) annexin A13
cow(614415) annexin A13
dog(403935) annexin A13
chicken(420342) annexin A13
sheep(101107203) annexin A13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134031 MISSION® esiRNA esiRNA human ANXA13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003954 Rosetta Predictions human pricing
NM_004306 Rosetta Predictions human pricing
NM_001134910 Rosetta Predictions rat pricing
NM_027211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141428 predicted 843
2 SASI_Hs01_00141429 predicted 1191
3 SASI_Hs01_00141430 predicted 897
4 SASI_Hs01_00141431 predicted 991
5 SASI_Hs01_00141432 predicted 1331
6 SASI_Hs01_00141433 predicted 1072
7 SASI_Hs01_00141434 predicted 1231
8 SASI_Hs01_00141435 predicted 911
9 SASI_Hs01_00141436 predicted 920
10 SASI_Hs01_00141437 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103027 predicted 723
2 SASI_Hs01_00103028 predicted 1062
3 SASI_Hs01_00103029 predicted 769
4 SASI_Hs01_00103030 predicted 866
5 SASI_Hs01_00103031 predicted 1211
6 SASI_Hs01_00103032 predicted 956
7 SASI_Hs01_00103033 predicted 1113
8 SASI_Hs01_00103034 predicted 791
9 SASI_Hs01_00103035 predicted 797
10 SASI_Hs01_00103036 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259024 predicted 728
2 SASI_Rn02_00259025 predicted 684
3 SASI_Rn02_00259026 predicted 747
4 SASI_Rn02_00259027 predicted 316
5 SASI_Rn02_00259028 predicted 202
6 SASI_Rn02_00259029 predicted 728
7 SASI_Rn02_00259030 predicted 984
8 SASI_Rn02_00259031 predicted 336
9 SASI_Rn02_00259032 predicted 475
10 SASI_Rn02_00259033 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146802 predicted 749
2 SASI_Mm01_00146803 predicted 761
3 SASI_Mm02_00331761 predicted 216
4 SASI_Mm01_00146804 predicted 736
5 SASI_Mm01_00146805 predicted 743
6 SASI_Mm01_00146806 predicted 730
7 SASI_Mm01_00146808 predicted 668
8 SASI_Mm01_00146809 predicted 607
9 SASI_Mm01_00146810 predicted 831
10 SASI_Mm01_00146811 predicted 223
11 SASI_Mm01_00146807 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003954
VALIDATED
ANXA13 MISSION shRNA Bacterial Glycerol Stock
annexin A13
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-817s21c1
Sequence:GTACCGGCACCTTTCAAGCCTATCAAATCTCGAGATTTGATAGGCTTGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-113s21c1
Sequence:GTACCGGGGCAGTCAACAGTTGCCTAAACTCGAGTTTAGGCAACTGTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1182s21c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-299s21c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-759s21c1
Sequence:GTACCGGCTGATGAGCTTGCGTTCAATGCTCGAGCATTGAACGCAAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-887s21c1
Sequence:GTACCGGGACTTGCAGAAGGCCTATTTACTCGAGTAAATAGGCCTTCTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1239s21c1
Sequence:GTACCGGACCCTTAAGAGTCCCGGATTACTCGAGTAATCCGGGACTCTTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-924s21c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1049s21c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-331s21c1
Sequence:GTACCGGATCAGATGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003954.1-1182s1c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003954.1-299s1c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-900s1c1
Sequence:CCGGCCTATTTAACTCTCGTGAGATCTCGAGATCTCACGAGAGTTAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-924s1c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-1049s1c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003954
VALIDATED
ANXA13 MISSION shRNA shRNA Plasmid DNA
annexin A13
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-817s21c1
Sequence:GTACCGGCACCTTTCAAGCCTATCAAATCTCGAGATTTGATAGGCTTGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-113s21c1
Sequence:GTACCGGGGCAGTCAACAGTTGCCTAAACTCGAGTTTAGGCAACTGTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1182s21c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-299s21c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-759s21c1
Sequence:GTACCGGCTGATGAGCTTGCGTTCAATGCTCGAGCATTGAACGCAAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-887s21c1
Sequence:GTACCGGGACTTGCAGAAGGCCTATTTACTCGAGTAAATAGGCCTTCTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1239s21c1
Sequence:GTACCGGACCCTTAAGAGTCCCGGATTACTCGAGTAATCCGGGACTCTTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-924s21c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1049s21c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-331s21c1
Sequence:GTACCGGATCAGATGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003954.1-1182s1c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003954.1-299s1c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-900s1c1
Sequence:CCGGCCTATTTAACTCTCGTGAGATCTCGAGATCTCACGAGAGTTAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-924s1c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-1049s1c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003954
VALIDATED
ANXA13 MISSION shRNA Lentiviral Transduction Particles
annexin A13
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-817s21c1
Sequence:GTACCGGCACCTTTCAAGCCTATCAAATCTCGAGATTTGATAGGCTTGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-113s21c1
Sequence:GTACCGGGGCAGTCAACAGTTGCCTAAACTCGAGTTTAGGCAACTGTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1182s21c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-299s21c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-759s21c1
Sequence:GTACCGGCTGATGAGCTTGCGTTCAATGCTCGAGCATTGAACGCAAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-887s21c1
Sequence:GTACCGGGACTTGCAGAAGGCCTATTTACTCGAGTAAATAGGCCTTCTGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1239s21c1
Sequence:GTACCGGACCCTTAAGAGTCCCGGATTACTCGAGTAATCCGGGACTCTTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-924s21c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003954.1-1049s21c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003954.1-331s21c1
Sequence:GTACCGGATCAGATGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCATCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003954.1-1182s1c1
Sequence:CCGGCGCCTTTGTCAAGAGCACATTCTCGAGAATGTGCTCTTGACAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001003954.1-299s1c1
Sequence:CCGGGCAGCCATCATTGAAATCTTACTCGAGTAAGATTTCAATGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-900s1c1
Sequence:CCGGCCTATTTAACTCTCGTGAGATCTCGAGATCTCACGAGAGTTAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-924s1c1
Sequence:CCGGCCCAGGATTGTGAGGACTATTCTCGAGAATAGTCCTCACAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003954.1-1049s1c1
Sequence:CCGGGCAAAGTTCCAAGAGAAGTATCTCGAGATACTTCTCTTGGAACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027211
VALIDATED
ANXA13 MISSION shRNA Bacterial Glycerol Stock
annexin A13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-389s21c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-207s21c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-843s21c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-367s21c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027211.2-1235s21c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027211.1-1235s1c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-843s1c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-207s1c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-389s1c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027211.1-367s1c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027211
VALIDATED
ANXA13 MISSION shRNA shRNA Plasmid DNA
annexin A13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-389s21c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-207s21c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-843s21c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-367s21c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027211.2-1235s21c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027211.1-1235s1c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-843s1c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-207s1c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-389s1c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027211.1-367s1c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027211
VALIDATED
ANXA13 MISSION shRNA Lentiviral Transduction Particles
annexin A13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-389s21c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-207s21c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-843s21c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027211.2-367s21c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027211.2-1235s21c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027211.1-1235s1c1
Sequence:CCGGGCGAATGCTTTCTAAGCACAACTCGAGTTGTGCTTAGAAAGCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-843s1c1
Sequence:CCGGGAGACATTAATTCGCATCATTCTCGAGAATGATGCGAATTAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-207s1c1
Sequence:CCGGCAGAAGTACAAGGAGAAGTATCTCGAGATACTTCTCCTTGTACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027211.1-389s1c1
Sequence:CCGGCACACGAAGCAACAAGGAAATCTCGAGATTTCCTTGTTGCTTCGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027211.1-367s1c1
Sequence:CCGGCCATGCTCATAGAGATCCTATCTCGAGATAGGATCTCTATGAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks