EMAIL THIS PAGE TO A FRIEND

ANXA1

annexin A1

69 Gene Product Result for
Synonyms: ANX1 LPC1
UniProtKB ID: P04083
Gene ID:
Human(301) Summary: Annexin I belongs to a family of Ca(2+)-dependent phospholipid binding proteins which have a molecular weight of approximately 35,000 to 40,000 and are preferentially located on the cytosolic face of the plasma membrane. Annexin I protein has an apparent relative molecular mass of 40 kDa, with phospholipase A2 inhibitory activity. Since phospholipase A2 is required for the biosynthesis of the potent mediators of inflammation, prostaglandins and leukotrienes, annexin I may have potential anti-inflammatory activity. [provided by RefSeq, Jul 2008]
Mouse(16952) annexin A1
Rat(25380) annexin A1
chicken(404271) annexin A1
Horse(100033940) annexin A1
cow(327662) annexin A1
dog(476322) annexin A1
sheep(101123269) annexin A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306513 ANTI-ANNEXIN A1 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2500072 Anti-Annexin I antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, pig, mouse, bovine
ELISA, western blot pricing
SAB1405457 Anti-ANXA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA011271 Anti-ANXA1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA011272 Anti-ANXA1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV36568 Anti-ANXA1 antibody produced in rabbit IgG fraction of antiserum pig, bovine, mouse, human, guinea pig, canine, rat
immunohistochemistry, western blot pricing
SAB1402115 Monoclonal Anti-ANXA1 antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90558 Monoclonal Anti-ANXA1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0199, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0098 AQUA Peptide TPAQFDADEL[R] dog, human, mouse, pig, rat pricing
AQ0137 AQUA Peptide GTDVNVFNTILTT[R] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000700 Rosetta Predictions human pricing
NM_012904 Rosetta Predictions rat pricing
NM_010730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157996 predicted 731
2 SASI_Hs01_00157997 predicted 1128
3 SASI_Hs01_00157998 predicted 1125
4 SASI_Hs01_00157999 predicted 498
5 SASI_Hs01_00158000 predicted 755
6 SASI_Hs01_00158001 predicted 977
7 SASI_Hs01_00158002 predicted 756
8 SASI_Hs01_00158003 predicted 682
9 SASI_Hs01_00158004 predicted 1134
10 SASI_Hs01_00158005 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106721 predicted 498
2 SASI_Rn01_00106722 predicted 736
3 SASI_Rn01_00106723 predicted 626
4 SASI_Rn01_00106724 predicted 973
5 SASI_Rn01_00106725 predicted 710
6 SASI_Rn01_00106726 predicted 1123
7 SASI_Rn02_00260439 predicted 843
8 SASI_Rn02_00260440 predicted 540
9 SASI_Rn01_00106730 predicted 1156
10 SASI_Rn02_00260441 predicted 590
11 SASI_Rn01_00106727 predicted 709
12 SASI_Rn01_00106728 predicted 975
13 SASI_Rn01_00106729 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319226 predicted 558
2 SASI_Mm01_00031884 predicted 211
3 SASI_Mm01_00031885 predicted 986
4 SASI_Mm01_00031886 predicted 636
5 SASI_Mm01_00031887 predicted 508
6 SASI_Mm01_00031888 predicted 977
7 SASI_Mm02_00319227 predicted 532
8 SASI_Mm02_00319228 predicted 861
9 SASI_Mm01_00031889 predicted 303
10 SASI_Mm01_00031890 predicted 254
11 SASI_Mm01_00031883 predicted 724
12 SASI_Mm01_00031891 predicted 504
13 SASI_Mm01_00031892 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000700
VALIDATED
ANXA1 MISSION shRNA Bacterial Glycerol Stock
annexin A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-687s1c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-417s1c1
Sequence:CCGGCCAGCGCAATTTGATGCTGATCTCGAGATCAGCATCAAATTGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-1011s1c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-261s1c1
Sequence:CCGGGCAACCATCATTGACATTCTACTCGAGTAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000700.1-559s21c1
Sequence:GTACCGGGAGATCTGGCCAAAGACATAACTCGAGTTATGTCTTTGGCCAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-228s21c1
Sequence:CCGGCATAAGGCCATAATGGTTAAACTCGAGTTTAACCATTATGGCCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1011s21c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-687s21c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-935s21c1
Sequence:CCGGAGGTGTTGGAACTCGCCATAACTCGAGTTATGGCGAGTTCCAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1138s21c1
Sequence:CCGGCTATGATCAGAAGACTTTAATCTCGAGATTAAAGTCTTCTGATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000700
VALIDATED
ANXA1 MISSION shRNA shRNA Plasmid DNA
annexin A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-687s1c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-417s1c1
Sequence:CCGGCCAGCGCAATTTGATGCTGATCTCGAGATCAGCATCAAATTGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-1011s1c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-261s1c1
Sequence:CCGGGCAACCATCATTGACATTCTACTCGAGTAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000700.1-559s21c1
Sequence:GTACCGGGAGATCTGGCCAAAGACATAACTCGAGTTATGTCTTTGGCCAGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-228s21c1
Sequence:CCGGCATAAGGCCATAATGGTTAAACTCGAGTTTAACCATTATGGCCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1011s21c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-687s21c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-935s21c1
Sequence:CCGGAGGTGTTGGAACTCGCCATAACTCGAGTTATGGCGAGTTCCAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1138s21c1
Sequence:CCGGCTATGATCAGAAGACTTTAATCTCGAGATTAAAGTCTTCTGATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000700
VALIDATED
ANXA1 MISSION shRNA Lentiviral Transduction Particles
annexin A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-687s1c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-417s1c1
Sequence:CCGGCCAGCGCAATTTGATGCTGATCTCGAGATCAGCATCAAATTGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000700.1-1011s1c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000700.1-261s1c1
Sequence:CCGGGCAACCATCATTGACATTCTACTCGAGTAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000700.1-559s21c1
Sequence:GTACCGGGAGATCTGGCCAAAGACATAACTCGAGTTATGTCTTTGGCCAGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-228s21c1
Sequence:CCGGCATAAGGCCATAATGGTTAAACTCGAGTTTAACCATTATGGCCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1011s21c1
Sequence:CCGGGCATTCTATCAGAAGATGTATCTCGAGATACATCTTCTGATAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-687s21c1
Sequence:CCGGGCCTTGTATGAAGCAGGAGAACTCGAGTTCTCCTGCTTCATACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-935s21c1
Sequence:CCGGAGGTGTTGGAACTCGCCATAACTCGAGTTATGGCGAGTTCCAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000700.1-1138s21c1
Sequence:CCGGCTATGATCAGAAGACTTTAATCTCGAGATTAAAGTCTTCTGATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010730
ANXA1 MISSION shRNA Bacterial Glycerol Stock
annexin A1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010730.1-1204s1c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-263s1c1
Sequence:CCGGGCAACCATCATTGACATTCTTCTCGAGAAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-229s1c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-656s1c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-982s1c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-980s21c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010730.2-1199s21c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-227s21c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-654s21c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010730
ANXA1 MISSION shRNA shRNA Plasmid DNA
annexin A1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010730.1-1204s1c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-263s1c1
Sequence:CCGGGCAACCATCATTGACATTCTTCTCGAGAAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-229s1c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-656s1c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-982s1c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-980s21c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010730.2-1199s21c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-227s21c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-654s21c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010730
ANXA1 MISSION shRNA Lentiviral Transduction Particles
annexin A1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010730.1-1204s1c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-263s1c1
Sequence:CCGGGCAACCATCATTGACATTCTTCTCGAGAAGAATGTCAATGATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-229s1c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-656s1c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010730.1-982s1c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-980s21c1
Sequence:CCGGCCGTTCGGAAATTGACATGAACTCGAGTTCATGTCAATTTCCGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010730.2-1199s21c1
Sequence:CCGGGCTTTGGCAGATAAGTCTAATCTCGAGATTAGACTTATCTGCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-227s21c1
Sequence:CCGGGCACAAAGCTATCATGGTTAACTCGAGTTAACCATGATAGCTTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010730.2-654s21c1
Sequence:CCGGGTGAATCAAGATTTGGCTGATCTCGAGATCAGCCAAATCTTGATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)