EMAIL THIS PAGE TO A FRIEND

ANXA2

annexin A2

82 Gene Product Result for
Synonyms: ANX2 ANX2L4 CAL1H LIP2 LPC2 LPC2D P36 PAP-IV
UniProtKB ID: P07355, Q567R4, Q6N0B3, Q8TBV2, Q96DD5, Q9UDH8
Gene ID:
Human(302) Summary: This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12306) annexin A2
Rat(56611) annexin A2
chicken(396297) annexin A2
cow(282689) annexin A2
Horse(100054320) annexin A2
dog(403435) annexin A2
sheep(100048993) annexin A2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007585 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007585 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007585 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002857 Rosetta Predictions human pricing
NM_001002858 Rosetta Predictions human pricing
NM_004039 Rosetta Predictions human pricing
NM_019905 Rosetta Predictions rat pricing
NM_007585 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246294 predicted 836
2 SASI_Hs01_00246295 predicted 1052
3 SASI_Hs01_00246296 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187107 predicted 822
2 SASI_Hs01_00187108 predicted 1050
3 SASI_Hs01_00187109 predicted 362
4 SASI_Hs01_00187110 predicted 101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136217 predicted 747
2 SASI_Hs01_00136218 predicted 978
3 SASI_Hs01_00136219 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033819 predicted 924
2 SASI_Rn01_00033820 predicted 744
3 SASI_Rn01_00033821 predicted 524
4 SASI_Rn01_00033822 predicted 428
5 SASI_Rn01_00033823 predicted 458
6 SASI_Rn01_00033824 predicted 462
7 SASI_Rn01_00033825 predicted 588
8 SASI_Rn01_00033826 predicted 1109
9 SASI_Rn01_00033827 predicted 970
10 SASI_Rn01_00033828 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187632 predicted 1000
2 SASI_Mm01_00187633 predicted 914
3 SASI_Mm01_00187634 predicted 392
4 SASI_Mm01_00187635 predicted 486
5 SASI_Mm02_00311982 predicted 1084
6 SASI_Mm01_00187636 predicted 557
7 SASI_Mm01_00187638 predicted 1146
8 SASI_Mm01_00187639 predicted 504
9 SASI_Mm01_00187640 predicted 334
10 SASI_Mm01_00187641 predicted 292
11 SASI_Mm01_00187637 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002857
VALIDATED
ANXA2 MISSION shRNA Bacterial Glycerol Stock
annexin A2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1470s1c1
Sequence:CCGGCCTGCTTTCAACTGAATTGTTCTCGAGAACAATTCAGTTGAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-245s1c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1079s1c1
Sequence:CCGGCTGTACTATTATATCCAGCAACTCGAGTTGCTGGATATAATAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002857.1-811s1c1
Sequence:CCGGCCAGAAAGTATTTGATAGGTACTCGAGTACCTATCAAATACTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-556s1c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-1259s21c1
Sequence:CCGGTGAGGGTGACGTTAGCATTACCTCGAGGTAATGCTAACGTCACCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-556s21c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-245s21c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1445s21c1
Sequence:CCGGACTTTAGAAACACGTACTTTGCTCGAGCAAAGTACGTGTTTCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1458s21c1
Sequence:CCGGGTACTTTGTGGCCCTGCTTTCCTCGAGGAAAGCAGGGCCACAAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002857
VALIDATED
ANXA2 MISSION shRNA shRNA Plasmid DNA
annexin A2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1470s1c1
Sequence:CCGGCCTGCTTTCAACTGAATTGTTCTCGAGAACAATTCAGTTGAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-245s1c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1079s1c1
Sequence:CCGGCTGTACTATTATATCCAGCAACTCGAGTTGCTGGATATAATAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002857.1-811s1c1
Sequence:CCGGCCAGAAAGTATTTGATAGGTACTCGAGTACCTATCAAATACTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-556s1c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-1259s21c1
Sequence:CCGGTGAGGGTGACGTTAGCATTACCTCGAGGTAATGCTAACGTCACCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-556s21c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-245s21c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1445s21c1
Sequence:CCGGACTTTAGAAACACGTACTTTGCTCGAGCAAAGTACGTGTTTCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1458s21c1
Sequence:CCGGGTACTTTGTGGCCCTGCTTTCCTCGAGGAAAGCAGGGCCACAAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002857
VALIDATED
ANXA2 MISSION shRNA Lentiviral Transduction Particles
annexin A2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1470s1c1
Sequence:CCGGCCTGCTTTCAACTGAATTGTTCTCGAGAACAATTCAGTTGAAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-245s1c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-1079s1c1
Sequence:CCGGCTGTACTATTATATCCAGCAACTCGAGTTGCTGGATATAATAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002857.1-811s1c1
Sequence:CCGGCCAGAAAGTATTTGATAGGTACTCGAGTACCTATCAAATACTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001002857.1-556s1c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-1259s21c1
Sequence:CCGGTGAGGGTGACGTTAGCATTACCTCGAGGTAATGCTAACGTCACCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-556s21c1
Sequence:CCGGGCAGGAAATTAACAGAGTCTACTCGAGTAGACTCTGTTAATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001002857.1-245s21c1
Sequence:CCGGCGGGATGCTTTGAACATTGAACTCGAGTTCAATGTTCAAAGCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1445s21c1
Sequence:CCGGACTTTAGAAACACGTACTTTGCTCGAGCAAAGTACGTGTTTCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002857.1-1458s21c1
Sequence:CCGGGTACTTTGTGGCCCTGCTTTCCTCGAGGAAAGCAGGGCCACAAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007585
VALIDATED
ANXA2 MISSION shRNA Bacterial Glycerol Stock
annexin A2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-627s1c1
Sequence:CCGGGTTATTGACTACGAGCTGATTCTCGAGAATCAGCTCGTAGTCAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-398s1c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-924s1c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-800s1c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-626s1c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-924s21c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-398s21c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-800s21c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-626s21c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007585
VALIDATED
ANXA2 MISSION shRNA shRNA Plasmid DNA
annexin A2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-627s1c1
Sequence:CCGGGTTATTGACTACGAGCTGATTCTCGAGAATCAGCTCGTAGTCAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-398s1c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-924s1c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-800s1c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-626s1c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-924s21c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-398s21c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-800s21c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-626s21c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007585
VALIDATED
ANXA2 MISSION shRNA Lentiviral Transduction Particles
annexin A2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-627s1c1
Sequence:CCGGGTTATTGACTACGAGCTGATTCTCGAGAATCAGCTCGTAGTCAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-398s1c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-924s1c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007585.2-800s1c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007585.2-626s1c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-924s21c1
Sequence:CCGGCGAGACAAGGTCCTGATTAGACTCGAGTCTAATCAGGACCTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-398s21c1
Sequence:CCGGGTATGATGCTTCGGAACTAAACTCGAGTTTAGTTCCGAAGCATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-800s21c1
Sequence:CCGGGAGCATCAAGAAAGAGGTCAACTCGAGTTGACCTCTTTCTTGATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007585.3-626s21c1
Sequence:CCGGAGTTATTGACTACGAGCTGATCTCGAGATCAGCTCGTAGTCAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)