EMAIL THIS PAGE TO A FRIEND

ANXA2R

annexin A2 receptor

21 Gene Product Result for
Synonyms: AX2R AXIIR C5orf39
Species: Human ANXA2R(389289)
UniProtKB ID: Q3ZCQ2, Q8NHX5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014279 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102741 MISSION® esiRNA esiRNA human C5orf39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132529 predicted 453
2 SASI_Hs01_00132530 predicted 832
3 SASI_Hs01_00132531 predicted 615
4 SASI_Hs01_00132532 predicted 278
5 SASI_Hs01_00132534 predicted 684
6 SASI_Hs01_00132535 predicted 532
7 SASI_Hs01_00132536 predicted 434
8 SASI_Hs01_00132538 predicted 493
9 SASI_Hs02_00306516 predicted 444
10 SASI_Hs02_00306517 predicted 326
11 SASI_Hs01_00132533 predicted 883
12 SASI_Hs01_00132537 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014279
ANXA2R MISSION shRNA Bacterial Glycerol Stock
annexin A2 receptor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-786s21c1
Sequence:CCGGTCAGACTGCCTGGAGTGGATTCTCGAGAATCCACTCCAGGCAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014279.2-963s21c1
Sequence:CCGGCATTAAGATGTGCTTTCATTGCTCGAGCAATGAAAGCACATCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-852s21c1
Sequence:CCGGTCACGGATCTGTGGAGCTAAGCTCGAGCTTAGCTCCACAGATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-535s21c1
Sequence:CCGGGCACCTTGGAACCAAGTACAGCTCGAGCTGTACTTGGTTCCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-275s1c1
Sequence:CCGGCCTCCACCTATTGTGAGTTCACTCGAGTGAACTCACAATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-919s1c1
Sequence:CCGGCCCTTATGTTTCTTTCTTGTTCTCGAGAACAAGAAAGAAACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-281s1c1
Sequence:CCGGCCTATTGTGAGTTCAGAAGATCTCGAGATCTTCTGAACTCACAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-839s1c1
Sequence:CCGGCCAAACGTCTCCACCTAGAAACTCGAGTTTCTAGGTGGAGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-706s1c1
Sequence:CCGGGTGGATTCTTCGCGTTGGTTTCTCGAGAAACCAACGCGAAGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-357s1c1
Sequence:CCGGGCTGTGATTTGGGACTGCTTTCTCGAGAAAGCAGTCCCAAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-943s1c1
Sequence:CCGGCGTCGCTTATTACTTTCAGTTCTCGAGAACTGAAAGTAATAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-346s1c1
Sequence:CCGGCTCACTGGACAGCTGTGATTTCTCGAGAAATCACAGCTGTCCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014279
ANXA2R MISSION shRNA shRNA Plasmid DNA
annexin A2 receptor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-786s21c1
Sequence:CCGGTCAGACTGCCTGGAGTGGATTCTCGAGAATCCACTCCAGGCAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014279.2-963s21c1
Sequence:CCGGCATTAAGATGTGCTTTCATTGCTCGAGCAATGAAAGCACATCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-852s21c1
Sequence:CCGGTCACGGATCTGTGGAGCTAAGCTCGAGCTTAGCTCCACAGATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-535s21c1
Sequence:CCGGGCACCTTGGAACCAAGTACAGCTCGAGCTGTACTTGGTTCCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-275s1c1
Sequence:CCGGCCTCCACCTATTGTGAGTTCACTCGAGTGAACTCACAATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-919s1c1
Sequence:CCGGCCCTTATGTTTCTTTCTTGTTCTCGAGAACAAGAAAGAAACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-281s1c1
Sequence:CCGGCCTATTGTGAGTTCAGAAGATCTCGAGATCTTCTGAACTCACAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-839s1c1
Sequence:CCGGCCAAACGTCTCCACCTAGAAACTCGAGTTTCTAGGTGGAGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-706s1c1
Sequence:CCGGGTGGATTCTTCGCGTTGGTTTCTCGAGAAACCAACGCGAAGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-357s1c1
Sequence:CCGGGCTGTGATTTGGGACTGCTTTCTCGAGAAAGCAGTCCCAAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-943s1c1
Sequence:CCGGCGTCGCTTATTACTTTCAGTTCTCGAGAACTGAAAGTAATAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-346s1c1
Sequence:CCGGCTCACTGGACAGCTGTGATTTCTCGAGAAATCACAGCTGTCCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014279
ANXA2R MISSION shRNA Lentiviral Transduction Particles
annexin A2 receptor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-786s21c1
Sequence:CCGGTCAGACTGCCTGGAGTGGATTCTCGAGAATCCACTCCAGGCAGTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001014279.2-963s21c1
Sequence:CCGGCATTAAGATGTGCTTTCATTGCTCGAGCAATGAAAGCACATCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-852s21c1
Sequence:CCGGTCACGGATCTGTGGAGCTAAGCTCGAGCTTAGCTCCACAGATCCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001014279.2-535s21c1
Sequence:CCGGGCACCTTGGAACCAAGTACAGCTCGAGCTGTACTTGGTTCCAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-275s1c1
Sequence:CCGGCCTCCACCTATTGTGAGTTCACTCGAGTGAACTCACAATAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-919s1c1
Sequence:CCGGCCCTTATGTTTCTTTCTTGTTCTCGAGAACAAGAAAGAAACATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-281s1c1
Sequence:CCGGCCTATTGTGAGTTCAGAAGATCTCGAGATCTTCTGAACTCACAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-839s1c1
Sequence:CCGGCCAAACGTCTCCACCTAGAAACTCGAGTTTCTAGGTGGAGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-706s1c1
Sequence:CCGGGTGGATTCTTCGCGTTGGTTTCTCGAGAAACCAACGCGAAGAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-357s1c1
Sequence:CCGGGCTGTGATTTGGGACTGCTTTCTCGAGAAAGCAGTCCCAAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001014279.1-943s1c1
Sequence:CCGGCGTCGCTTATTACTTTCAGTTCTCGAGAACTGAAAGTAATAAGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014279.1-346s1c1
Sequence:CCGGCTCACTGGACAGCTGTGATTTCTCGAGAAATCACAGCTGTCCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks