EMAIL THIS PAGE TO A FRIEND

ANXA3

annexin A3

56 Gene Product Result for
Synonyms: ANX3
UniProtKB ID: P12429, B2R9W6, Q6LET2
Gene ID:
Human(306) Summary: This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions in the inhibition of phopholipase A2 and cleavage of inositol 1,2-cyclic phosphate to form inositol 1-phosphate. This protein may also play a role in anti-coagulation. [provided by RefSeq, Jul 2008]
Mouse(11745) annexin A3
Rat(25291) annexin A3
dog(478447) annexin A3
cow(518050) annexin A3
sheep(101111885) annexin A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005139 Rosetta Predictions human pricing
NM_012823 Rosetta Predictions rat pricing
NM_013470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339067 predicted 1342
2 SASI_Hs01_00049504 predicted 399
3 SASI_Hs01_00049506 predicted 1328
4 SASI_Hs01_00049507 predicted 728
5 SASI_Hs01_00049508 predicted 636
6 SASI_Hs01_00049509 predicted 1185
7 SASI_Hs01_00049510 predicted 1230
8 SASI_Hs01_00049511 predicted 1120
9 SASI_Hs01_00049512 predicted 601
10 SASI_Hs01_00049513 predicted 687
11 SASI_Hs01_00049505 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044388 predicted 469
2 SASI_Rn01_00044389 predicted 920
3 SASI_Rn01_00044390 predicted 505
4 SASI_Rn01_00044391 predicted 459
5 SASI_Rn01_00044392 predicted 911
6 SASI_Rn01_00044393 predicted 271
7 SASI_Rn01_00044394 predicted 254
8 SASI_Rn01_00044395 predicted 486
9 SASI_Rn01_00044396 predicted 812
10 SASI_Rn01_00044397 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169933 predicted 289
2 SASI_Mm01_00169934 predicted 1259
3 SASI_Mm02_00322088 predicted 587
4 SASI_Mm01_00169935 predicted 1026
5 SASI_Mm01_00169936 predicted 601
6 SASI_Mm01_00169937 predicted 546
7 SASI_Mm01_00169938 predicted 1096
8 SASI_Mm01_00169939 predicted 642
9 SASI_Mm01_00169940 predicted 1042
10 SASI_Mm01_00169941 predicted 1100
11 SASI_Mm01_00169942 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013470
VALIDATED
ANXA3 MISSION shRNA Bacterial Glycerol Stock
annexin A3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1246s1c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1102s1c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-819s1c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-696s1c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-876s1c1
Sequence:CCGGGACAGCATTAAAGGAGAATTACTCGAGTAATTCTCCTTTAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-1119s21c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-713s21c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013470.2-1263s21c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-836s21c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-596s21c1
Sequence:CCGGGAAATCTCGCAGGCCTATTATCTCGAGATAATAGGCCTGCGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013470
VALIDATED
ANXA3 MISSION shRNA shRNA Plasmid DNA
annexin A3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1246s1c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1102s1c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-819s1c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-696s1c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-876s1c1
Sequence:CCGGGACAGCATTAAAGGAGAATTACTCGAGTAATTCTCCTTTAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-1119s21c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-713s21c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013470.2-1263s21c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-836s21c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-596s21c1
Sequence:CCGGGAAATCTCGCAGGCCTATTATCTCGAGATAATAGGCCTGCGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013470
VALIDATED
ANXA3 MISSION shRNA Lentiviral Transduction Particles
annexin A3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110725    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1246s1c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-1102s1c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-819s1c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-696s1c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013470.1-876s1c1
Sequence:CCGGGACAGCATTAAAGGAGAATTACTCGAGTAATTCTCCTTTAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-1119s21c1
Sequence:CCGGCGGCCATCCAATCAGATACTTCTCGAGAAGTATCTGATTGGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-713s21c1
Sequence:CCGGGAAAGCCTCAAAGTGGATGAACTCGAGTTCATCCACTTTGAGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013470.2-1263s21c1
Sequence:CCGGGCACTCTAAAGTGCAAGCAAACTCGAGTTTGCTTGCACTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-836s21c1
Sequence:CCGGCCGCAGCTGAAACTAACATTTCTCGAGAAATGTTAGTTTCAGCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013470.2-596s21c1
Sequence:CCGGGAAATCTCGCAGGCCTATTATCTCGAGATAATAGGCCTGCGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005139
VALIDATED
ANXA3 MISSION shRNA Bacterial Glycerol Stock
annexin A3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-569s1c1
Sequence:CCGGGCCAAACAAGATGCCCAGATTCTCGAGAATCTGGGCATCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-879s1c1
Sequence:CCGGCCAGATCAGAAATTGACCTTTCTCGAGAAAGGTCAATTTCTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-468s1c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-80s1c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-948s1c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1086s21c1
Sequence:GTACCGGATCGAGCCTTGAAGGGTATTGCTCGAGCAATACCCTTCAAGGCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005139.2-1461s21c1
Sequence:GTACCGGTATAATGTAGCAGCTCATAAACTCGAGTTTATGAGCTGCTACATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1117s21c1
Sequence:GTACCGGGTTTACTCTGAACCGAATAATCTCGAGATTATTCGGTTCAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-842s21c1
Sequence:GTACCGGGATGCCCAGATTCTCTATAAACTCGAGTTTATAGAGAATCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-344s21c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1212s21c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-732s21c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-689s21c1
Sequence:CCGGGATATCTCTCAAGCCTATTATCTCGAGATAATAGGCTTGAGAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1335s21c1
Sequence:CCGGCTTACTTCTTCTCATACTATTCTCGAGAATAGTATGAGAAGAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005139
VALIDATED
ANXA3 MISSION shRNA shRNA Plasmid DNA
annexin A3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-569s1c1
Sequence:CCGGGCCAAACAAGATGCCCAGATTCTCGAGAATCTGGGCATCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-879s1c1
Sequence:CCGGCCAGATCAGAAATTGACCTTTCTCGAGAAAGGTCAATTTCTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-468s1c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-80s1c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-948s1c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1086s21c1
Sequence:GTACCGGATCGAGCCTTGAAGGGTATTGCTCGAGCAATACCCTTCAAGGCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005139.2-1461s21c1
Sequence:GTACCGGTATAATGTAGCAGCTCATAAACTCGAGTTTATGAGCTGCTACATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1117s21c1
Sequence:GTACCGGGTTTACTCTGAACCGAATAATCTCGAGATTATTCGGTTCAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-842s21c1
Sequence:GTACCGGGATGCCCAGATTCTCTATAAACTCGAGTTTATAGAGAATCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-344s21c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1212s21c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-732s21c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-689s21c1
Sequence:CCGGGATATCTCTCAAGCCTATTATCTCGAGATAATAGGCTTGAGAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1335s21c1
Sequence:CCGGCTTACTTCTTCTCATACTATTCTCGAGAATAGTATGAGAAGAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005139
VALIDATED
ANXA3 MISSION shRNA Lentiviral Transduction Particles
annexin A3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-569s1c1
Sequence:CCGGGCCAAACAAGATGCCCAGATTCTCGAGAATCTGGGCATCTTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005139.1-879s1c1
Sequence:CCGGCCAGATCAGAAATTGACCTTTCTCGAGAAAGGTCAATTTCTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-468s1c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-80s1c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005139.1-948s1c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1086s21c1
Sequence:GTACCGGATCGAGCCTTGAAGGGTATTGCTCGAGCAATACCCTTCAAGGCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005139.2-1461s21c1
Sequence:GTACCGGTATAATGTAGCAGCTCATAAACTCGAGTTTATGAGCTGCTACATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-1117s21c1
Sequence:GTACCGGGTTTACTCTGAACCGAATAATCTCGAGATTATTCGGTTCAGAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005139.2-842s21c1
Sequence:GTACCGGGATGCCCAGATTCTCTATAAACTCGAGTTTATAGAGAATCTGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-344s21c1
Sequence:CCGGGTAAGAGATTATCCAGACTTTCTCGAGAAAGTCTGGATAATCTCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1212s21c1
Sequence:CCGGCAGCAATTAAATCGGATACTTCTCGAGAAGTATCCGATTTAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-732s21c1
Sequence:CCGGGAGATGACATTAGTTCCGAAACTCGAGTTTCGGAACTAATGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-689s21c1
Sequence:CCGGGATATCTCTCAAGCCTATTATCTCGAGATAATAGGCTTGAGAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005139.2-1335s21c1
Sequence:CCGGCTTACTTCTTCTCATACTATTCTCGAGAATAGTATGAGAAGAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks