EMAIL THIS PAGE TO A FRIEND

ANXA4

annexin A4

122 Gene Product Result for
Synonyms: ANX4 PIG28 ZAP36
UniProtKB ID: P09525, Q96F33, Q9BWK1
Gene ID:
Human(307) Summary: Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. [provided by RefSeq, Jul 2008]
Mouse(11746) annexin A4
Rat(79124) annexin A4
Zebrafish(353362) annexin A4
cow(281625) annexin A4
dog(606756) annexin A4
sheep(101107176) annexin A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405459 Anti-ANXA4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA007393 Anti-ANXA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV36686 Anti-ANXA4 antibody produced in rabbit IgG fraction of antiserum human, pig, rabbit, horse, bovine, rat, canine, zebrafish, guinea pig, mouse
immunohistochemistry, western blot pricing
SAB2100126 Anti-ANXA4 antibody produced in rabbit affinity isolated antibody , bovine, human, rat, guinea pig, pig, canine, rabbit, mouse, horse
western blot pricing
SAB4200121 Monoclonal Anti-Annexin 4 antibody produced in mouse ~1.5 mg/mL, clone ANX47, purified immunoglobulin monkey, human, bovine, mouse
immunohistochemistry, western blot pricing
SAB1402116 Monoclonal Anti-ANXA4 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001153 Rosetta Predictions human pricing
NM_024155 Rosetta Predictions rat pricing
NM_013471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159273 predicted 1154
2 SASI_Hs01_00159274 predicted 378
3 SASI_Hs01_00159275 predicted 543
4 SASI_Hs02_00331258 predicted 232
5 SASI_Hs01_00159276 predicted 814
6 SASI_Hs01_00159277 predicted 410
7 SASI_Hs01_00159278 predicted 864
8 SASI_Hs01_00159279 predicted 1261
9 SASI_Hs02_00331259 predicted 891
10 SASI_Hs02_00331260 predicted 324
11 SASI_Hs01_00159280 predicted 693
12 SASI_Hs01_00159281 predicted 489
13 SASI_Hs01_00159282 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083471 predicted 462
2 SASI_Rn01_00083472 predicted 737
3 SASI_Rn01_00083473 predicted 1112
4 SASI_Rn01_00083474 predicted 207
5 SASI_Rn02_00263887 predicted 884
6 SASI_Rn01_00083475 predicted 842
7 SASI_Rn01_00083477 predicted 821
8 SASI_Rn01_00083479 predicted 501
9 SASI_Rn01_00083480 predicted 525
10 SASI_Rn02_00263888 predicted 770
11 SASI_Rn01_00083476 predicted 237
12 SASI_Rn01_00083478 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089961 predicted 492
2 SASI_Mm01_00089962 predicted 768
3 SASI_Mm02_00322089 predicted 1549
4 SASI_Mm02_00322090 predicted 227
5 SASI_Mm01_00089969 predicted 1563
6 SASI_Mm02_00322091 predicted 1563
7 SASI_Mm02_00322092 predicted 494
8 SASI_Mm01_00089963 predicted 598
9 SASI_Mm02_00322093 predicted 233
10 SASI_Mm02_00322094 predicted 201
11 SASI_Mm01_00089964 predicted 714
12 SASI_Mm01_00089965 predicted 846
13 SASI_Mm01_00089966 predicted 776
14 SASI_Mm01_00089967 predicted 757
15 SASI_Mm01_00089968 predicted 218
16 SASI_Mm01_00089970 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001153
VALIDATED
ANXA4 MISSION shRNA Bacterial Glycerol Stock
annexin A4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-327s21c1
Sequence:GTACCGGACCGATGAAGACGCCATTATTCTCGAGAATAATGGCGTCTTCATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-935s21c1
Sequence:GTACCGGTGCTCTGCTGGCTATAGTAAACTCGAGTTTACTATAGCCAGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001153.3-1616s21c1
Sequence:GTACCGGTGTAAGCATCCGGTCAGTAAGCTCGAGCTTACTGACCGGATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-637s21c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1059s21c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-887s21c1
Sequence:CCGGGGATATTGAACAGAGTATTAACTCGAGTTAATACTCTGTTCAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1086s21c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-1255s21c1
Sequence:CCGGTCTACACTGCTATTATCATTACTCGAGTAATGATAATAGCAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-932s1c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-787s1c1
Sequence:CCGGGCTGGCTATAGTAAAGTGCATCTCGAGATGCACTTTACTATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-483s1c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-182s1c1
Sequence:CCGGGACGCCATTATTAGCGTCCTTCTCGAGAAGGACGCTAATAATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-905s1c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001153
VALIDATED
ANXA4 MISSION shRNA shRNA Plasmid DNA
annexin A4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-327s21c1
Sequence:GTACCGGACCGATGAAGACGCCATTATTCTCGAGAATAATGGCGTCTTCATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-935s21c1
Sequence:GTACCGGTGCTCTGCTGGCTATAGTAAACTCGAGTTTACTATAGCCAGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001153.3-1616s21c1
Sequence:GTACCGGTGTAAGCATCCGGTCAGTAAGCTCGAGCTTACTGACCGGATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-637s21c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1059s21c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-887s21c1
Sequence:CCGGGGATATTGAACAGAGTATTAACTCGAGTTAATACTCTGTTCAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1086s21c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-1255s21c1
Sequence:CCGGTCTACACTGCTATTATCATTACTCGAGTAATGATAATAGCAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-932s1c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-787s1c1
Sequence:CCGGGCTGGCTATAGTAAAGTGCATCTCGAGATGCACTTTACTATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-483s1c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-182s1c1
Sequence:CCGGGACGCCATTATTAGCGTCCTTCTCGAGAAGGACGCTAATAATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-905s1c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001153
VALIDATED
ANXA4 MISSION shRNA Lentiviral Transduction Particles
annexin A4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-327s21c1
Sequence:GTACCGGACCGATGAAGACGCCATTATTCTCGAGAATAATGGCGTCTTCATCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-935s21c1
Sequence:GTACCGGTGCTCTGCTGGCTATAGTAAACTCGAGTTTACTATAGCCAGCAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001153.3-1616s21c1
Sequence:GTACCGGTGTAAGCATCCGGTCAGTAAGCTCGAGCTTACTGACCGGATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-637s21c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1059s21c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-887s21c1
Sequence:CCGGGGATATTGAACAGAGTATTAACTCGAGTTAATACTCTGTTCAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001153.3-1086s21c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001153.3-1255s21c1
Sequence:CCGGTCTACACTGCTATTATCATTACTCGAGTAATGATAATAGCAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-932s1c1
Sequence:CCGGGCACACTTCAAGAGACTCTATCTCGAGATAGAGTCTCTTGAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-787s1c1
Sequence:CCGGGCTGGCTATAGTAAAGTGCATCTCGAGATGCACTTTACTATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-483s1c1
Sequence:CCGGGCCTTGAAGATGACATTCGCTCTCGAGAGCGAATGTCATCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001153.2-182s1c1
Sequence:CCGGGACGCCATTATTAGCGTCCTTCTCGAGAAGGACGCTAATAATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001153.2-905s1c1
Sequence:CCGGGCAGAAATTGACATGTTGGATCTCGAGATCCAACATGTCAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013471
VALIDATED
ANXA4 MISSION shRNA Bacterial Glycerol Stock
annexin A4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-848s21c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-482s21c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013471.2-1325s21c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-233s21c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-992s21c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-1293s1c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-963s1c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-453s1c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-204s1c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-819s1c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013471
VALIDATED
ANXA4 MISSION shRNA shRNA Plasmid DNA
annexin A4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-848s21c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-482s21c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013471.2-1325s21c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-233s21c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-992s21c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-1293s1c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-963s1c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-453s1c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-204s1c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-819s1c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013471
VALIDATED
ANXA4 MISSION shRNA Lentiviral Transduction Particles
annexin A4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-848s21c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-482s21c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013471.2-1325s21c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-233s21c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013471.2-992s21c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-1293s1c1
Sequence:CCGGCCACGTCTTTATCAGATTATTCTCGAGAATAATCTGATAAAGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-963s1c1
Sequence:CCGGCGGGAAGTCTTTGTACTCTTTCTCGAGAAAGAGTACAAAGACTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-453s1c1
Sequence:CCGGCCGTCGAATCAACCAGACATACTCGAGTATGTCTGGTTGATTCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-204s1c1
Sequence:CCGGCGGAATCTTAGCCTACAGAAACTCGAGTTTCTGTAGGCTAAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013471.1-819s1c1
Sequence:CCGGGCGGAGTAAACCTTCATATTTCTCGAGAAATATGAAGGTTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks