EMAIL THIS PAGE TO A FRIEND

ANXA6

annexin A6

107 Gene Product Result for
Synonyms: ANX6 CBP68
UniProtKB ID: P08133, B7Z8A7, D3DQH4, E9PGK1, Q6ZT79
Gene ID:
Human(309) Summary: Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
Mouse(11749) annexin A6
Rat(79125) annexin A6
Zebrafish(353363) annexin A6
dog(479325) annexin A6
Horse(100071569) annexin A6
cow(327685) annexin A6
chicken(395481) annexin A6
sheep(101105245) annexin A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001155 Rosetta Predictions human pricing
NM_004033 Rosetta Predictions human pricing
NM_024156 Rosetta Predictions rat pricing
XM_579485 Rosetta Predictions rat pricing
NM_001110211 Rosetta Predictions mouse pricing
NM_013472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063383 predicted 431
2 SASI_Hs02_00331265 predicted 1377
3 SASI_Hs01_00063384 predicted 401
4 SASI_Hs01_00063385 predicted 1301
5 SASI_Hs01_00063386 predicted 869
6 SASI_Hs01_00063387 predicted 1048
7 SASI_Hs02_00331266 predicted 1456
8 SASI_Hs01_00063388 predicted 1167
9 SASI_Hs02_00331267 predicted 1022
10 SASI_Hs01_00063389 predicted 1366
11 SASI_Hs01_00063390 predicted 1230
12 SASI_Hs01_00063391 predicted 2045
13 SASI_Hs01_00063392 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086100 predicted 425
2 SASI_Hs02_00336777 predicted 1383
3 SASI_Hs01_00086101 predicted 397
4 SASI_Hs01_00086102 predicted 1297
5 SASI_Hs01_00086103 predicted 867
6 SASI_Hs01_00086104 predicted 1046
7 SASI_Hs02_00336778 predicted 1456
8 SASI_Hs01_00086105 predicted 1165
9 SASI_Hs02_00336779 predicted 1015
10 SASI_Hs01_00086106 predicted 1368
11 SASI_Hs01_00086107 predicted 1230
12 SASI_Hs01_00086108 predicted 2027
13 SASI_Hs01_00086109 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030622 predicted 1528
2 SASI_Rn02_00263889 predicted 361
3 SASI_Rn01_00030623 predicted 597
4 SASI_Rn01_00030624 predicted 1812
5 SASI_Rn02_00263890 predicted 1871
6 SASI_Rn01_00030625 predicted 1581
7 SASI_Rn01_00030626 predicted 1321
8 SASI_Rn01_00030629 predicted 1891
9 SASI_Rn01_00030630 predicted 980
10 SASI_Rn02_00263891 predicted 725
11 SASI_Rn01_00030621 predicted 1304
12 SASI_Rn01_00030627 predicted 978
13 SASI_Rn01_00030628 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164043 predicted 1502
2 SASI_Rn01_00164044 predicted 889
3 SASI_Rn01_00164045 predicted 580
4 SASI_Rn01_00164046 predicted 1784
5 SASI_Rn01_00164047 predicted 505
6 SASI_Rn01_00164048 predicted 1552
7 SASI_Rn01_00164049 predicted 289
8 SASI_Rn01_00164050 predicted 358
9 SASI_Rn01_00164051 predicted 961
10 SASI_Rn01_00164052 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304956 predicted 1921
2 SASI_Mm02_00304957 predicted 639
3 SASI_Mm02_00304958 predicted 1351
4 SASI_Mm02_00304959 predicted 1365
5 SASI_Mm02_00304960 predicted 2008
6 SASI_Mm02_00304961 predicted 417
7 SASI_Mm02_00304962 predicted 659
8 SASI_Mm02_00304963 predicted 265
9 SASI_Mm02_00304964 predicted 2055
10 SASI_Mm02_00304965 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322095 predicted 1939
2 SASI_Mm01_00065464 predicted 643
3 SASI_Mm01_00065469 predicted 1350
4 SASI_Mm02_00322096 predicted 1366
5 SASI_Mm02_00322097 predicted 2024
6 SASI_Mm02_00322098 predicted 418
7 SASI_Mm02_00322099 predicted 660
8 SASI_Mm01_00065472 predicted 272
9 SASI_Mm02_00322100 predicted 2071
10 SASI_Mm02_00322101 predicted 458
11 SASI_Mm01_00065465 predicted 1505
12 SASI_Mm01_00065466 predicted 1794
13 SASI_Mm01_00065467 predicted 1847
14 SASI_Mm01_00065468 predicted 1866
15 SASI_Mm01_00065470 predicted 1876
16 SASI_Mm01_00065471 predicted 1556
17 SASI_Mm01_00065473 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001155
VALIDATED
ANXA6 MISSION shRNA Bacterial Glycerol Stock
annexin A6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-391s21c1
Sequence:GTACCGGGCAAGTTTGAACGGTTGATTGCTCGAGCAATCAACCGTTCAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1565s21c1
Sequence:GTACCGGGGCCATCAATGAGGCCTATAACTCGAGTTATAGGCCTCATTGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001155.3-2582s21c1
Sequence:GTACCGGGGTGGTGGGAAGGATAGTAAACTCGAGTTTACTATCCTTCCCACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1298s21c1
Sequence:GTACCGGCGAAGACACAATCATCGATATCTCGAGATATCGATGATTGTGTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1000s21c1
Sequence:GTACCGGAGTTGGACATGCTCGACATTCCTCGAGGAATGTCGAGCATGTCCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-355s21c1
Sequence:GTACCGGAGGACCTCATTGCTGATTTAACTCGAGTTAAATCAGCAATGAGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-787s21c1
Sequence:GTACCGGGGTTGGTGTTCGATGAGTATCCTCGAGGATACTCATCGAACACCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-2207s1c1
Sequence:CCGGCGGGCACTTCTGCCAAGAAATCTCGAGATTTCTTGGCAGAAGTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001155.2-1985s1c1
Sequence:CCGGCGACAAACTTTACAAATCCATCTCGAGATGGATTTGTAAAGTTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-804s1c1
Sequence:CCGGCGGTTGGTGTTCGATGAGTATCTCGAGATACTCATCGAACACCAACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-1185s1c1
Sequence:CCGGGCCTATCAGATGTGGGAACTTCTCGAGAAGTTCCCACATCTGATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-447s1c1
Sequence:CCGGCCTGCCTATTGTGATGCCAAACTCGAGTTTGGCATCACAATAGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001155
VALIDATED
ANXA6 MISSION shRNA shRNA Plasmid DNA
annexin A6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-391s21c1
Sequence:GTACCGGGCAAGTTTGAACGGTTGATTGCTCGAGCAATCAACCGTTCAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1565s21c1
Sequence:GTACCGGGGCCATCAATGAGGCCTATAACTCGAGTTATAGGCCTCATTGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001155.3-2582s21c1
Sequence:GTACCGGGGTGGTGGGAAGGATAGTAAACTCGAGTTTACTATCCTTCCCACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1298s21c1
Sequence:GTACCGGCGAAGACACAATCATCGATATCTCGAGATATCGATGATTGTGTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1000s21c1
Sequence:GTACCGGAGTTGGACATGCTCGACATTCCTCGAGGAATGTCGAGCATGTCCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-355s21c1
Sequence:GTACCGGAGGACCTCATTGCTGATTTAACTCGAGTTAAATCAGCAATGAGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-787s21c1
Sequence:GTACCGGGGTTGGTGTTCGATGAGTATCCTCGAGGATACTCATCGAACACCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-2207s1c1
Sequence:CCGGCGGGCACTTCTGCCAAGAAATCTCGAGATTTCTTGGCAGAAGTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001155.2-1985s1c1
Sequence:CCGGCGACAAACTTTACAAATCCATCTCGAGATGGATTTGTAAAGTTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-804s1c1
Sequence:CCGGCGGTTGGTGTTCGATGAGTATCTCGAGATACTCATCGAACACCAACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-1185s1c1
Sequence:CCGGGCCTATCAGATGTGGGAACTTCTCGAGAAGTTCCCACATCTGATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-447s1c1
Sequence:CCGGCCTGCCTATTGTGATGCCAAACTCGAGTTTGGCATCACAATAGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001155
VALIDATED
ANXA6 MISSION shRNA Lentiviral Transduction Particles
annexin A6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-391s21c1
Sequence:GTACCGGGCAAGTTTGAACGGTTGATTGCTCGAGCAATCAACCGTTCAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1565s21c1
Sequence:GTACCGGGGCCATCAATGAGGCCTATAACTCGAGTTATAGGCCTCATTGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001155.3-2582s21c1
Sequence:GTACCGGGGTGGTGGGAAGGATAGTAAACTCGAGTTTACTATCCTTCCCACCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1298s21c1
Sequence:GTACCGGCGAAGACACAATCATCGATATCTCGAGATATCGATGATTGTGTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-1000s21c1
Sequence:GTACCGGAGTTGGACATGCTCGACATTCCTCGAGGAATGTCGAGCATGTCCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-355s21c1
Sequence:GTACCGGAGGACCTCATTGCTGATTTAACTCGAGTTAAATCAGCAATGAGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001155.3-787s21c1
Sequence:GTACCGGGGTTGGTGTTCGATGAGTATCCTCGAGGATACTCATCGAACACCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-2207s1c1
Sequence:CCGGCGGGCACTTCTGCCAAGAAATCTCGAGATTTCTTGGCAGAAGTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001155.2-1985s1c1
Sequence:CCGGCGACAAACTTTACAAATCCATCTCGAGATGGATTTGTAAAGTTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-804s1c1
Sequence:CCGGCGGTTGGTGTTCGATGAGTATCTCGAGATACTCATCGAACACCAACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-1185s1c1
Sequence:CCGGGCCTATCAGATGTGGGAACTTCTCGAGAAGTTCCCACATCTGATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001155.2-447s1c1
Sequence:CCGGCCTGCCTATTGTGATGCCAAACTCGAGTTTGGCATCACAATAGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013472
VALIDATED
ANXA6 MISSION shRNA Bacterial Glycerol Stock
annexin A6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013472.4-2240s21c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1940s21c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1345s21c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-773s21c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1207s21c1
Sequence:GTACCGGTGTGTGTGCAGCCAATGATTTCTCGAGAAATCATTGGCTGCACACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-646s21c1
Sequence:GTACCGGCGATGTTGTGAGCGAGGATTTCTCGAGAAATCCTCGCTCACAACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-2183s1c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1884s1c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1289s1c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013472.2-261s1c1
Sequence:CCGGCAGAATTACAAGTCCCTGTATCTCGAGATACAGGGACTTGTAATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-717s1c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013472
VALIDATED
ANXA6 MISSION shRNA shRNA Plasmid DNA
annexin A6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013472.4-2240s21c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1940s21c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1345s21c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-773s21c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1207s21c1
Sequence:GTACCGGTGTGTGTGCAGCCAATGATTTCTCGAGAAATCATTGGCTGCACACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-646s21c1
Sequence:GTACCGGCGATGTTGTGAGCGAGGATTTCTCGAGAAATCCTCGCTCACAACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-2183s1c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1884s1c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1289s1c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013472.2-261s1c1
Sequence:CCGGCAGAATTACAAGTCCCTGTATCTCGAGATACAGGGACTTGTAATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-717s1c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013472
VALIDATED
ANXA6 MISSION shRNA Lentiviral Transduction Particles
annexin A6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013472.4-2240s21c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1940s21c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1345s21c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-773s21c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-1207s21c1
Sequence:GTACCGGTGTGTGTGCAGCCAATGATTTCTCGAGAAATCATTGGCTGCACACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013472.4-646s21c1
Sequence:GTACCGGCGATGTTGTGAGCGAGGATTTCTCGAGAAATCCTCGCTCACAACATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-2183s1c1
Sequence:CCGGTGCTCCAGCTTCAGGATCTAACTCGAGTTAGATCCTGAAGCTGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1884s1c1
Sequence:CCGGCCTCTCTTCTTTGCTGATAAACTCGAGTTTATCAGCAAAGAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-1289s1c1
Sequence:CCGGGCAGACCTTCAAATCTCACTTCTCGAGAAGTGAGATTTGAAGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013472.2-261s1c1
Sequence:CCGGCAGAATTACAAGTCCCTGTATCTCGAGATACAGGGACTTGTAATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013472.2-717s1c1
Sequence:CCGGCGACTGGTGTTTGATGAGTATCTCGAGATACTCATCAAACACCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)