EMAIL THIS PAGE TO A FRIEND

ANXA7

annexin A7

111 Gene Product Result for
Synonyms: ANX7 SNX SYNEXIN
UniProtKB ID: P20073, Q5F2H3, Q5T0M6, Q5T0M7
Gene ID:
Human(310) Summary: Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
Mouse(11750) annexin A7
Rat(155423) annexin A7
sheep(101118663) annexin A7
chicken(423747) annexin A7
cow(533360) annexin A7
dog(479246) annexin A7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001156 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001156 Rosetta Predictions human pricing
NM_004034 Rosetta Predictions human pricing
NM_130416 Rosetta Predictions rat pricing
NM_001110794 Rosetta Predictions mouse pricing
NM_009674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187037 predicted 762
2 SASI_Hs01_00187038 predicted 1147
3 SASI_Hs02_00331268 predicted 1149
4 SASI_Hs01_00187039 predicted 709
5 SASI_Hs01_00187040 predicted 931
6 SASI_Hs01_00187041 predicted 725
7 SASI_Hs01_00187042 predicted 993
8 SASI_Hs01_00187043 predicted 1150
9 SASI_Hs01_00187044 predicted 835
10 SASI_Hs01_00187046 predicted 1197
11 SASI_Hs01_00187045 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022242 predicted 832
2 SASI_Hs01_00022243 predicted 1215
3 SASI_Hs02_00336780 predicted 1213
4 SASI_Hs01_00022244 predicted 782
5 SASI_Hs01_00022245 predicted 999
6 SASI_Hs01_00022246 predicted 792
7 SASI_Hs01_00022247 predicted 1058
8 SASI_Hs01_00022248 predicted 1222
9 SASI_Hs01_00022249 predicted 896
10 SASI_Hs01_00022251 predicted 1263
11 SASI_Hs01_00022250 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058438 predicted 851
2 SASI_Rn01_00058439 predicted 1572
3 SASI_Rn01_00058440 predicted 943
4 SASI_Rn01_00058441 predicted 1163
5 SASI_Rn01_00058442 predicted 1017
6 SASI_Rn02_00267414 predicted 637
7 SASI_Rn01_00058444 predicted 699
8 SASI_Rn02_00267415 predicted 1235
9 SASI_Rn01_00058446 predicted 1308
10 SASI_Rn01_00058447 predicted 1434
11 SASI_Rn01_00058443 predicted 783
12 SASI_Rn01_00058445 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305748 predicted 1039
2 SASI_Mm02_00305749 predicted 1031
3 SASI_Mm02_00305750 predicted 785
4 SASI_Mm02_00305751 predicted 979
5 SASI_Mm02_00305752 predicted 851
6 SASI_Mm02_00305753 predicted 1236
7 SASI_Mm02_00305754 predicted 709
8 SASI_Mm02_00305755 predicted 1086
9 SASI_Mm02_00305756 predicted 1557
10 SASI_Mm02_00305757 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092272 predicted 1153
2 SASI_Mm01_00092273 predicted 1142
3 SASI_Mm01_00092274 predicted 899
4 SASI_Mm01_00092275 predicted 1098
5 SASI_Mm01_00092278 predicted 965
6 SASI_Mm02_00316722 predicted 1350
7 SASI_Mm01_00092279 predicted 822
8 SASI_Mm01_00092280 predicted 1201
9 SASI_Mm01_00092281 predicted 1668
10 SASI_Mm02_00316723 predicted 1211
11 SASI_Mm01_00092276 predicted 1307
12 SASI_Mm01_00092277 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009674
VALIDATED
ANXA7 MISSION shRNA Bacterial Glycerol Stock
annexin A7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1643s1c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1132s1c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009674.1-1133s1c1
Sequence:CCGGGCGATTTGCTAAGCAGTGTAACTCGAGTTACACTGCTTAGCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-549s1c1
Sequence:CCGGCCGCAAAGCAATGAAAGGGTTCTCGAGAACCCTTTCATTGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1237s1c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1550s21c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1956s21c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1099s21c1
Sequence:CCGGAGGAACTCAAGAACGTGTATTCTCGAGAATACACGTTCTTGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1445s21c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1411s21c1
Sequence:CCGGGGCCACTATGGAGGCTTATTCCTCGAGGAATAAGCCTCCATAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009674
VALIDATED
ANXA7 MISSION shRNA shRNA Plasmid DNA
annexin A7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1643s1c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1132s1c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009674.1-1133s1c1
Sequence:CCGGGCGATTTGCTAAGCAGTGTAACTCGAGTTACACTGCTTAGCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-549s1c1
Sequence:CCGGCCGCAAAGCAATGAAAGGGTTCTCGAGAACCCTTTCATTGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1237s1c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1550s21c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1956s21c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1099s21c1
Sequence:CCGGAGGAACTCAAGAACGTGTATTCTCGAGAATACACGTTCTTGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1445s21c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1411s21c1
Sequence:CCGGGGCCACTATGGAGGCTTATTCCTCGAGGAATAAGCCTCCATAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009674
VALIDATED
ANXA7 MISSION shRNA Lentiviral Transduction Particles
annexin A7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1643s1c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1132s1c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009674.1-1133s1c1
Sequence:CCGGGCGATTTGCTAAGCAGTGTAACTCGAGTTACACTGCTTAGCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-549s1c1
Sequence:CCGGCCGCAAAGCAATGAAAGGGTTCTCGAGAACCCTTTCATTGCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009674.1-1237s1c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1550s21c1
Sequence:CCGGCGACTCTACTATTCCATGAAACTCGAGTTTCATGGAATAGTAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1956s21c1
Sequence:CCGGGCCATATCAATGACGTAGTAACTCGAGTTACTACGTCATTGATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1099s21c1
Sequence:CCGGAGGAACTCAAGAACGTGTATTCTCGAGAATACACGTTCTTGAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1445s21c1
Sequence:CCGGCGCGATTTGCTAAGCAGTGTACTCGAGTACACTGCTTAGCAAATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009674.3-1411s21c1
Sequence:CCGGGGCCACTATGGAGGCTTATTCCTCGAGGAATAAGCCTCCATAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001156
VALIDATED
ANXA7 MISSION shRNA Bacterial Glycerol Stock
annexin A7
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-996s1c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-538s1c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1193s1c1
Sequence:CCGGCCGGATATGTAGAAAGTGGTTCTCGAGAACCACTTTCTACATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1428s1c1
Sequence:CCGGCCGAAGACTTCTTCTGGCTATCTCGAGATAGCCAGAAGAAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-871s1c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1072s21c1
Sequence:GTACCGGGAGACTAGGGACCGATGAATCCTCGAGGATTCATCGGTCCCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1137s21c1
Sequence:GTACCGGGAGCTACCATGGAGGCTTATTCTCGAGAATAAGCCTCCATGGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-884s21c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-1009s21c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-769s21c1
Sequence:CCGGCTTCATGCCTCCTACGTATTACTCGAGTAATACGTAGGAGGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1744s21c1
Sequence:CCGGTCTAATCAAGATGTCAAATTGCTCGAGCAATTTGACATCTTGATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-551s21c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-826s21c1
Sequence:GTACCGGAGGAACTCAGGAACGTGTATTCTCGAGAATACACGTTCCTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001156
VALIDATED
ANXA7 MISSION shRNA shRNA Plasmid DNA
annexin A7
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-996s1c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-538s1c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1193s1c1
Sequence:CCGGCCGGATATGTAGAAAGTGGTTCTCGAGAACCACTTTCTACATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1428s1c1
Sequence:CCGGCCGAAGACTTCTTCTGGCTATCTCGAGATAGCCAGAAGAAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-871s1c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1072s21c1
Sequence:GTACCGGGAGACTAGGGACCGATGAATCCTCGAGGATTCATCGGTCCCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1137s21c1
Sequence:GTACCGGGAGCTACCATGGAGGCTTATTCTCGAGAATAAGCCTCCATGGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-884s21c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-1009s21c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-769s21c1
Sequence:CCGGCTTCATGCCTCCTACGTATTACTCGAGTAATACGTAGGAGGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1744s21c1
Sequence:CCGGTCTAATCAAGATGTCAAATTGCTCGAGCAATTTGACATCTTGATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-551s21c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-826s21c1
Sequence:GTACCGGAGGAACTCAGGAACGTGTATTCTCGAGAATACACGTTCCTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001156
VALIDATED
ANXA7 MISSION shRNA Lentiviral Transduction Particles
annexin A7
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-996s1c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-538s1c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1193s1c1
Sequence:CCGGCCGGATATGTAGAAAGTGGTTCTCGAGAACCACTTTCTACATATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001156.2-1428s1c1
Sequence:CCGGCCGAAGACTTCTTCTGGCTATCTCGAGATAGCCAGAAGAAGTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001156.2-871s1c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1072s21c1
Sequence:GTACCGGGAGACTAGGGACCGATGAATCCTCGAGGATTCATCGGTCCCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1137s21c1
Sequence:GTACCGGGAGCTACCATGGAGGCTTATTCTCGAGAATAAGCCTCCATGGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-884s21c1
Sequence:CCGGCGAGAAATTGTCAGATGTTATCTCGAGATAACATCTGACAATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-1009s21c1
Sequence:CCGGCCAGAGTATAAACCACCAAATCTCGAGATTTGGTGGTTTATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-769s21c1
Sequence:CCGGCTTCATGCCTCCTACGTATTACTCGAGTAATACGTAGGAGGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001156.3-1744s21c1
Sequence:CCGGTCTAATCAAGATGTCAAATTGCTCGAGCAATTTGACATCTTGATTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-551s21c1
Sequence:CCGGGCTGCCAACTTCGATGCTATACTCGAGTATAGCATCGAAGTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001156.3-826s21c1
Sequence:GTACCGGAGGAACTCAGGAACGTGTATTCTCGAGAATACACGTTCCTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks