EMAIL THIS PAGE TO A FRIEND

ANXA8

annexin A8

198 Gene Product Result for
Synonyms: ANX8
UniProtKB ID: P13928, A6NLM1, Q5VTM4, Q6GMY3, Q9BT34
Gene ID:
Human(653145) Summary: This gene encodes a member of the annexin family of evolutionarily conserved Ca2+ and phospholipid binding proteins. The encoded protein may function as an an anticoagulant that indirectly inhibits the thromboplastin-specific complex. Overexpression of this gene has been associated with acute myelocytic leukemia. A highly similar duplicated copy of this gene is found in close proximity on the long arm of chromosome 10. [provided by RefSeq, Jul 2008]
Mouse(11752) annexin A8
Rat(306283) annexin A8
chicken(423774) annexin A8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001040084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040084 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034391 MISSION® esiRNA esiRNA targeting mouse Anxa8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040084 Rosetta Predictions human pricing
XM_927047 Rosetta Predictions human pricing
XM_931775 Rosetta Predictions human pricing
XM_931784 Rosetta Predictions human pricing
XM_931789 Rosetta Predictions human pricing
XM_931794 Rosetta Predictions human pricing
XM_931800 Rosetta Predictions human pricing
XM_931805 Rosetta Predictions human pricing
XM_931812 Rosetta Predictions human pricing
XM_931816 Rosetta Predictions human pricing
XM_931825 Rosetta Predictions human pricing
XM_931832 Rosetta Predictions human pricing
XM_931835 Rosetta Predictions human pricing
XM_931838 Rosetta Predictions human pricing
XM_931844 Rosetta Predictions human pricing
NM_001031654 Rosetta Predictions rat pricing
NM_013473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091429 predicted 1040
2 SASI_Hs02_00308805 predicted 210
3 SASI_Hs02_00308806 predicted 968
4 SASI_Hs01_00091433 predicted 1049
5 SASI_Hs02_00308807 predicted 468
6 SASI_Hs02_00308808 predicted 774
7 SASI_Hs02_00308809 predicted 846
8 SASI_Hs02_00308810 predicted 570
9 SASI_Hs02_00308811 predicted 454
10 SASI_Hs02_00308812 predicted 980
11 SASI_Hs01_00091425 predicted 1287
12 SASI_Hs01_00091426 predicted 1012
13 SASI_Hs01_00091427 predicted 1136
14 SASI_Hs01_00091428 predicted 1016
15 SASI_Hs01_00091430 predicted 1098
16 SASI_Hs01_00091431 predicted 467
17 SASI_Hs01_00091432 predicted 1190
18 SASI_Hs01_00091434 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265103 predicted 989
2 SASI_Hs01_00265104 predicted 913
3 SASI_Hs01_00265105 predicted 1000
4 SASI_Hs01_00265106 predicted 272
5 SASI_Hs01_00265107 predicted 423
6 SASI_Hs01_00265108 predicted 722
7 SASI_Hs01_00265109 predicted 795
8 SASI_Hs01_00265110 predicted 1006
9 SASI_Hs01_00265111 predicted 525
10 SASI_Hs01_00265112 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287132 predicted 984
2 SASI_Hs01_00287133 predicted 912
3 SASI_Hs01_00287134 predicted 1004
4 SASI_Hs01_00287135 predicted 272
5 SASI_Hs01_00287136 predicted 414
6 SASI_Hs01_00287137 predicted 718
7 SASI_Hs01_00287138 predicted 1192
8 SASI_Hs01_00287139 predicted 790
9 SASI_Hs01_00287140 predicted 1011
10 SASI_Hs01_00287141 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298398 predicted 458
2 SASI_Hs01_00298399 predicted 626
3 SASI_Hs01_00298400 predicted 649
4 SASI_Hs01_00298401 predicted 442
5 SASI_Hs01_00298402 predicted 535
6 SASI_Hs01_00298403 predicted 398
7 SASI_Hs01_00298404 predicted 390
8 SASI_Hs01_00298405 predicted 739
9 SASI_Hs01_00298406 predicted 633
10 SASI_Hs01_00298407 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252720 predicted 984
2 SASI_Hs01_00252721 predicted 793
3 SASI_Hs01_00252722 predicted 628
4 SASI_Hs01_00252723 predicted 972
5 SASI_Hs01_00252724 predicted 599
6 SASI_Hs01_00252725 predicted 992
7 SASI_Hs01_00252726 predicted 718
8 SASI_Hs01_00252727 predicted 779
9 SASI_Hs01_00252728 predicted 1065
10 SASI_Hs01_00252729 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296199 predicted 606
2 SASI_Hs01_00296200 predicted 631
3 SASI_Hs01_00296201 predicted 593
4 SASI_Hs01_00296202 predicted 606
5 SASI_Hs01_00296203 predicted 581
6 SASI_Hs01_00296204 predicted 632
7 SASI_Hs01_00296205 predicted 605
8 SASI_Hs01_00296206 predicted 629
9 SASI_Hs01_00296207 predicted 625
10 SASI_Hs01_00296208 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264257 predicted 211
2 SASI_Hs01_00264258 predicted 311
3 SASI_Hs01_00264259 predicted 247
4 SASI_Hs01_00264260 predicted 313
5 SASI_Hs01_00264261 predicted 213
6 SASI_Hs01_00264262 predicted 307
7 SASI_Hs01_00264263 predicted 247
8 SASI_Hs01_00264264 predicted 307
9 SASI_Hs01_00264265 predicted 237
10 SASI_Hs01_00264266 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273899 predicted 459
2 SASI_Hs01_00273900 predicted 630
3 SASI_Hs01_00273901 predicted 543
4 SASI_Hs01_00273902 predicted 1171
5 SASI_Hs01_00273903 predicted 811
6 SASI_Hs01_00273904 predicted 899
7 SASI_Hs01_00273905 predicted 903
8 SASI_Hs01_00273906 predicted 1012
9 SASI_Hs01_00273907 predicted 923
10 SASI_Hs01_00273908 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298840 predicted 581
2 SASI_Hs01_00298841 predicted 462
3 SASI_Hs01_00298842 predicted 626
4 SASI_Hs01_00298843 predicted 540
5 SASI_Hs01_00298844 predicted 984
6 SASI_Hs01_00298845 predicted 720
7 SASI_Hs01_00298846 predicted 725
8 SASI_Hs01_00298847 predicted 830
9 SASI_Hs01_00298848 predicted 744
10 SASI_Hs01_00298849 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279238 predicted 359
2 SASI_Hs01_00279239 predicted 358
3 SASI_Hs01_00279240 predicted 253
4 SASI_Hs01_00279241 predicted 702
5 SASI_Hs01_00279242 predicted 440
6 SASI_Hs01_00279243 predicted 442
7 SASI_Hs01_00279244 predicted 549
8 SASI_Hs01_00279245 predicted 468
9 SASI_Hs01_00279246 predicted 527
10 SASI_Hs01_00279247 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258607 predicted 985
2 SASI_Hs01_00258608 predicted 911
3 SASI_Hs01_00258609 predicted 994
4 SASI_Hs01_00258610 predicted 269
5 SASI_Hs01_00258611 predicted 419
6 SASI_Hs01_00258612 predicted 725
7 SASI_Hs01_00258613 predicted 1203
8 SASI_Hs01_00258614 predicted 796
9 SASI_Hs01_00258615 predicted 1003
10 SASI_Hs01_00258616 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272194 predicted 986
2 SASI_Hs01_00272195 predicted 916
3 SASI_Hs01_00272196 predicted 1001
4 SASI_Hs01_00272197 predicted 277
5 SASI_Hs01_00272198 predicted 417
6 SASI_Hs01_00272199 predicted 718
7 SASI_Hs01_00272200 predicted 792
8 SASI_Hs01_00272201 predicted 1009
9 SASI_Hs01_00272202 predicted 519
10 SASI_Hs01_00272203 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252690 predicted 607
2 SASI_Hs01_00252691 predicted 773
3 SASI_Hs01_00252692 predicted 331
4 SASI_Hs01_00252693 predicted 963
5 SASI_Hs01_00252694 predicted 1078
6 SASI_Hs01_00252695 predicted 360
7 SASI_Hs01_00252696 predicted 985
8 SASI_Hs01_00252697 predicted 1042
9 SASI_Hs01_00252698 predicted 413
10 SASI_Hs01_00252699 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260467 predicted 603
2 SASI_Hs01_00260468 predicted 607
3 SASI_Hs01_00260469 predicted 499
4 SASI_Hs01_00260470 predicted 401
5 SASI_Hs01_00260471 predicted 951
6 SASI_Hs01_00260472 predicted 682
7 SASI_Hs01_00260473 predicted 682
8 SASI_Hs01_00260474 predicted 800
9 SASI_Hs01_00260475 predicted 704
10 SASI_Hs01_00260476 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259493 predicted 730
2 SASI_Hs01_00259494 predicted 454
3 SASI_Hs01_00259495 predicted 745
4 SASI_Hs01_00259496 predicted 629
5 SASI_Hs01_00259497 predicted 540
6 SASI_Hs01_00259498 predicted 1089
7 SASI_Hs01_00259499 predicted 820
8 SASI_Hs01_00259500 predicted 815
9 SASI_Hs01_00259501 predicted 935
10 SASI_Hs01_00259502 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051288 predicted 393
2 SASI_Rn01_00051289 predicted 514
3 SASI_Rn01_00051290 predicted 861
4 SASI_Rn01_00051291 predicted 652
5 SASI_Rn01_00051292 predicted 683
6 SASI_Rn01_00051293 predicted 598
7 SASI_Rn01_00051294 predicted 281
8 SASI_Rn01_00051295 predicted 825
9 SASI_Rn01_00051296 predicted 646
10 SASI_Rn01_00051297 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194098 predicted 729
2 SASI_Mm01_00194099 predicted 704
3 SASI_Mm01_00194100 predicted 310
4 SASI_Mm01_00194102 predicted 913
5 SASI_Mm02_00322102 predicted 916
6 SASI_Mm01_00194103 predicted 557
7 SASI_Mm02_00322103 predicted 402
8 SASI_Mm01_00194104 predicted 823
9 SASI_Mm01_00194105 predicted 455
10 SASI_Mm01_00194106 predicted 841
11 SASI_Mm01_00194101 predicted 259
12 SASI_Mm01_00194107 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013473
VALIDATED
ANXA8 MISSION shRNA Bacterial Glycerol Stock
annexin A8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-108s21c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-913s21c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-637s21c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-1651s1c1
Sequence:CCGGCCATCCTAATAGCACGCATTACTCGAGTAATGCGTGCTATTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-937s1c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-661s1c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-132s1c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-914s1c1
Sequence:CCGGCGCTGATAAGGAACATTGTTTCTCGAGAAACAATGTTCCTTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013473
VALIDATED
ANXA8 MISSION shRNA shRNA Plasmid DNA
annexin A8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-108s21c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-913s21c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-637s21c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-1651s1c1
Sequence:CCGGCCATCCTAATAGCACGCATTACTCGAGTAATGCGTGCTATTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-937s1c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-661s1c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-132s1c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-914s1c1
Sequence:CCGGCGCTGATAAGGAACATTGTTTCTCGAGAAACAATGTTCCTTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013473
VALIDATED
ANXA8 MISSION shRNA Lentiviral Transduction Particles
annexin A8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-108s21c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-913s21c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013473.3-637s21c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-1651s1c1
Sequence:CCGGCCATCCTAATAGCACGCATTACTCGAGTAATGCGTGCTATTAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-937s1c1
Sequence:CCGGAGGAGTGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-661s1c1
Sequence:CCGGGAGAAGATTATGGGAACCGATCTCGAGATCGGTTCCCATAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-132s1c1
Sequence:CCGGCGTGAAGGGTAGTTCTCATTTCTCGAGAAATGAGAACTACCCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013473.2-914s1c1
Sequence:CCGGCGCTGATAAGGAACATTGTTTCTCGAGAAACAATGTTCCTTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040084
VALIDATED
ANXA8 MISSION shRNA Bacterial Glycerol Stock
annexin A8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-786s21c1
Sequence:CCGGTGGGACTGATGAGATGAAATTCTCGAGAATTTCATCTCATCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1520s21c1
Sequence:CCGGTCTCCTGGGCACAGGTTATACCTCGAGGTATAACCTGTGCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-579s21c1
Sequence:CCGGGAACCAGCTGCGGGAGATAATCTCGAGATTATCTCCCGCAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040084.1-602s21c1
Sequence:CCGGAGGCGTATGAGGAAGACTATGCTCGAGCATAGTCTTCCTCATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1049s21c1
Sequence:CCGGCAAGGAGCGAGATTGACTTAACTCGAGTTAAGTCAATCTCGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040084
VALIDATED
ANXA8 MISSION shRNA shRNA Plasmid DNA
annexin A8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-786s21c1
Sequence:CCGGTGGGACTGATGAGATGAAATTCTCGAGAATTTCATCTCATCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1520s21c1
Sequence:CCGGTCTCCTGGGCACAGGTTATACCTCGAGGTATAACCTGTGCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-579s21c1
Sequence:CCGGGAACCAGCTGCGGGAGATAATCTCGAGATTATCTCCCGCAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040084.1-602s21c1
Sequence:CCGGAGGCGTATGAGGAAGACTATGCTCGAGCATAGTCTTCCTCATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1049s21c1
Sequence:CCGGCAAGGAGCGAGATTGACTTAACTCGAGTTAAGTCAATCTCGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040084
VALIDATED
ANXA8 MISSION shRNA Lentiviral Transduction Particles
annexin A8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-786s21c1
Sequence:CCGGTGGGACTGATGAGATGAAATTCTCGAGAATTTCATCTCATCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1520s21c1
Sequence:CCGGTCTCCTGGGCACAGGTTATACCTCGAGGTATAACCTGTGCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-579s21c1
Sequence:CCGGGAACCAGCTGCGGGAGATAATCTCGAGATTATCTCCCGCAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040084.1-602s21c1
Sequence:CCGGAGGCGTATGAGGAAGACTATGCTCGAGCATAGTCTTCCTCATACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040084.1-1049s21c1
Sequence:CCGGCAAGGAGCGAGATTGACTTAACTCGAGTTAAGTCAATCTCGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks