EMAIL THIS PAGE TO A FRIEND

ANXA8L1

annexin A8-like 1

16 Gene Product Result for
Synonyms: ANXA8 VAC-beta
UniProtKB ID: Q5T2P8, A6NDE6
Gene ID:
cow(281627) annexin A8-like 1
Horse(100052045) annexin A8-like 1
dog(479270) annexin A8-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098845 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320184 predicted 953
2 SASI_Hs02_00320185 predicted 888
3 SASI_Hs02_00320186 predicted 964
4 SASI_Hs02_00320187 predicted 245
5 SASI_Hs02_00320188 predicted 383
6 SASI_Hs02_00320189 predicted 687
7 SASI_Hs02_00320190 predicted 756
8 SASI_Hs02_00320191 predicted 975
9 SASI_Hs02_00320192 predicted 487
10 SASI_Hs02_00320193 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098845
VALIDATED
ANXA8L1 MISSION shRNA Bacterial Glycerol Stock
annexin A8-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-1437s21c1
Sequence:CCGGGTCTCCTGGGCACAGGTTATACTCGAGTATAACCTGTGCCCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-895s21c1
Sequence:CCGGTTGCAGAGAGACTCTACTATGCTCGAGCATAGTAGAGTCTCTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-969s21c1
Sequence:CCGGAGGAGCGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-496s21c1
Sequence:CCGGAGAACCAGCTGCGGGAGATAACTCGAGTTATCTCCCGCAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-393s21c1
Sequence:CCGGATGTACCCGCCATACAGATACCTCGAGGTATCTGTATGGCGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098845
VALIDATED
ANXA8L1 MISSION shRNA shRNA Plasmid DNA
annexin A8-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-1437s21c1
Sequence:CCGGGTCTCCTGGGCACAGGTTATACTCGAGTATAACCTGTGCCCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-895s21c1
Sequence:CCGGTTGCAGAGAGACTCTACTATGCTCGAGCATAGTAGAGTCTCTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-969s21c1
Sequence:CCGGAGGAGCGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-496s21c1
Sequence:CCGGAGAACCAGCTGCGGGAGATAACTCGAGTTATCTCCCGCAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-393s21c1
Sequence:CCGGATGTACCCGCCATACAGATACCTCGAGGTATCTGTATGGCGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098845
VALIDATED
ANXA8L1 MISSION shRNA Lentiviral Transduction Particles
annexin A8-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-1437s21c1
Sequence:CCGGGTCTCCTGGGCACAGGTTATACTCGAGTATAACCTGTGCCCAGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-895s21c1
Sequence:CCGGTTGCAGAGAGACTCTACTATGCTCGAGCATAGTAGAGTCTCTCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-969s21c1
Sequence:CCGGAGGAGCGAGATTGACTTAAATCTCGAGATTTAAGTCAATCTCGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-496s21c1
Sequence:CCGGAGAACCAGCTGCGGGAGATAACTCGAGTTATCTCCCGCAGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001098845.1-393s21c1
Sequence:CCGGATGTACCCGCCATACAGATACCTCGAGGTATCTGTATGGCGGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks