EMAIL THIS PAGE TO A FRIEND

ANXA8L2

annexin A8-like 2

33 Gene Product Result for
Synonyms: ANXA8 bA145E20.2
Species: Human ANXA8L2(244)
UniProtKB ID: Q5VT79, B2R939, Q53FY2, Q5VT78, Q96H89
Gene ID:
Human(244) Summary: This gene encodes a member of the annexin family of evolutionarily conserved Ca2+ and phospholipid binding proteins. The encoded protein may function as an an anticoagulant that indirectly inhibits the thromboplastin-specific complex. Overexpression of this gene has been associated with acute myelocytic leukemia. A highly similar duplicated copy of this gene is found in close proximity on the long arm of chromosome 10. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36575 Anti-ANXA8L2 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, rabbit, rat, bovine, human, canine, horse
western blot pricing
SAB2100127 Anti-ANXA8L2 antibody produced in rabbit affinity isolated antibody zebrafish, horse, human, rabbit, rabbit, canine, mouse, rat, guinea pig, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001630 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001630 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097996 predicted 1031
2 SASI_Hs02_00332204 predicted 740
3 SASI_Hs02_00332205 predicted 757
4 SASI_Hs02_00332206 predicted 949
5 SASI_Hs01_00098000 predicted 1042
6 SASI_Hs02_00332207 predicted 453
7 SASI_Hs02_00332208 predicted 828
8 SASI_Hs02_00332209 predicted 195
9 SASI_Hs02_00332210 predicted 559
10 SASI_Hs02_00332211 predicted 440
11 SASI_Hs01_00097992 predicted 1270
12 SASI_Hs01_00097993 predicted 1000
13 SASI_Hs01_00097994 predicted 1116
14 SASI_Hs01_00097995 predicted 1009
15 SASI_Hs01_00097997 predicted 1094
16 SASI_Hs01_00097998 predicted 460
17 SASI_Hs01_00097999 predicted 1178
18 SASI_Hs01_00098001 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001630
ANXA8L2 MISSION shRNA Bacterial Glycerol Stock
annexin A8-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001630.2-445s21c1
Sequence:CCGAAGGCTCATTGTGGCCCTTATGCTCGAGCATAAGGGCCACAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001630.2-1275s21c1
Sequence:CCGGAGCCTTTCGGTCTTCTATTTCCTCGAGGAAATAGAAGACCGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-491s1c1
Sequence:CCGGCGGGAGATAATGAAGGCGTATCTCGAGATACGCCTTCATTATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-930s1c1
Sequence:CCGGCCCTGATAAGAAACATCGTTTCTCGAGAAACGATGTTTCTTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-957s1c1
Sequence:CCGGGCGAGATTGACTTAAATCTTACTCGAGTAAGATTTAAGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-190s1c1
Sequence:CCGGGACCCTCTACAAAGCCATGAACTCGAGTTCATGGCTTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-686s1c1
Sequence:CCGGCGTGGGACTGATGAGATGAAACTCGAGTTTCATCTCATCAGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001630
ANXA8L2 MISSION shRNA shRNA Plasmid DNA
annexin A8-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001630.2-445s21c1
Sequence:CCGAAGGCTCATTGTGGCCCTTATGCTCGAGCATAAGGGCCACAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001630.2-1275s21c1
Sequence:CCGGAGCCTTTCGGTCTTCTATTTCCTCGAGGAAATAGAAGACCGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-491s1c1
Sequence:CCGGCGGGAGATAATGAAGGCGTATCTCGAGATACGCCTTCATTATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-930s1c1
Sequence:CCGGCCCTGATAAGAAACATCGTTTCTCGAGAAACGATGTTTCTTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-957s1c1
Sequence:CCGGGCGAGATTGACTTAAATCTTACTCGAGTAAGATTTAAGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-190s1c1
Sequence:CCGGGACCCTCTACAAAGCCATGAACTCGAGTTCATGGCTTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-686s1c1
Sequence:CCGGCGTGGGACTGATGAGATGAAACTCGAGTTTCATCTCATCAGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001630
ANXA8L2 MISSION shRNA Lentiviral Transduction Particles
annexin A8-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001630.2-445s21c1
Sequence:CCGAAGGCTCATTGTGGCCCTTATGCTCGAGCATAAGGGCCACAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001630.2-1275s21c1
Sequence:CCGGAGCCTTTCGGTCTTCTATTTCCTCGAGGAAATAGAAGACCGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-491s1c1
Sequence:CCGGCGGGAGATAATGAAGGCGTATCTCGAGATACGCCTTCATTATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-930s1c1
Sequence:CCGGCCCTGATAAGAAACATCGTTTCTCGAGAAACGATGTTTCTTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-957s1c1
Sequence:CCGGGCGAGATTGACTTAAATCTTACTCGAGTAAGATTTAAGTCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-190s1c1
Sequence:CCGGGACCCTCTACAAAGCCATGAACTCGAGTTCATGGCTTTGTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001630.1-686s1c1
Sequence:CCGGCGTGGGACTGATGAGATGAAACTCGAGTTTCATCTCATCAGTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks