EMAIL THIS PAGE TO A FRIEND

ANXA9

annexin A9

61 Gene Product Result for
Synonyms: ANX31
UniProtKB ID: O76027, Q5SZF1, Q6FI55, Q9BS00, Q9HBJ6
Gene ID:
Human(8416) Summary: The annexins are a family of calcium-dependent phospholipid-binding proteins. Members of the annexin family contain 4 internal repeat domains, each of which includes a type II calcium-binding site. The calcium-binding sites are required for annexins to aggregate and cooperatively bind anionic phospholipids and extracellular matrix proteins. This gene encodes a divergent member of the annexin protein family in which all four homologous type II calcium-binding sites in the conserved tetrad core contain amino acid substitutions that ablate their function. However, structural analysis suggests that the conserved putative ion channel formed by the tetrad core is intact. [provided by RefSeq, Jul 2008]
Mouse(71790) annexin A9
Rat(689830) annexin A9
dog(475840) annexin A9
cow(528055) annexin A9
sheep(101109752) annexin A9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003568 Rosetta Predictions human pricing
XM_001072193 Rosetta Predictions rat pricing
NM_001085383 Rosetta Predictions mouse pricing
NM_023628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246490 predicted 1330
2 SASI_Hs01_00246492 predicted 624
3 SASI_Hs01_00246494 predicted 1142
4 SASI_Hs01_00246495 predicted 1287
5 SASI_Hs01_00246496 predicted 741
6 SASI_Hs01_00246497 predicted 1424
7 SASI_Hs01_00246498 predicted 1324
8 SASI_Hs02_00335874 predicted 964
9 SASI_Hs01_00246499 predicted 877
10 SASI_Hs02_00335875 predicted 1252
11 SASI_Hs01_00246491 predicted 758
12 SASI_Hs01_00246493 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338151 predicted 1292
2 SASI_Rn02_00338152 predicted 1282
3 SASI_Rn02_00338153 predicted 1292
4 SASI_Rn02_00338154 predicted 1260
5 SASI_Rn02_00338155 predicted 1292
6 SASI_Rn02_00338156 predicted 1271
7 SASI_Rn02_00338157 predicted 1279
8 SASI_Rn02_00338158 predicted 1277
9 SASI_Rn02_00338159 predicted 1259
10 SASI_Rn02_00338160 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300275 predicted 475
2 SASI_Mm02_00300276 predicted 815
3 SASI_Mm02_00300277 predicted 1218
4 SASI_Mm02_00300278 predicted 702
5 SASI_Mm02_00300279 predicted 385
6 SASI_Mm02_00300280 predicted 635
7 SASI_Mm02_00300281 predicted 923
8 SASI_Mm02_00300282 predicted 1076
9 SASI_Mm02_00300283 predicted 491
10 SASI_Mm02_00300284 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327241 predicted 459
2 SASI_Mm01_00076551 predicted 796
3 SASI_Mm01_00076552 predicted 1192
4 SASI_Mm01_00076553 predicted 682
5 SASI_Mm01_00076554 predicted 363
6 SASI_Mm01_00076555 predicted 605
7 SASI_Mm01_00076556 predicted 899
8 SASI_Mm01_00076557 predicted 1052
9 SASI_Mm01_00076559 predicted 479
10 SASI_Mm01_00076560 predicted 810
11 SASI_Mm01_00076558 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003568
ANXA9 MISSION shRNA Bacterial Glycerol Stock
annexin A9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-1277s1c1
Sequence:CCGGCCCAATTACCAAGTCCTGATTCTCGAGAATCAGGACTTGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-868s1c1
Sequence:CCGGCCTGGCAGTCTACAAACACAACTCGAGTTGTGTTTGTAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-998s1c1
Sequence:CCGGGACTATAATCTGGCAGAACAACTCGAGTTGTTCTGCCAGATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-643s1c1
Sequence:CCGGGCAGCTCATCTCACGAAACTTCTCGAGAAGTTTCGTGAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-517s1c1
Sequence:CCGGCCTCAGGACCTTCTTGAACTTCTCGAGAAGTTCAAGAAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003568.2-816s21c1
Sequence:CCGGCAGTTTGACGCCCAGGAATTGCTCGAGCAATTCCTGGGCGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003568.2-1542s21c1
Sequence:CCGGGATCTGAGATTTCCGTGTTTGCTCGAGCAAACACGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003568
ANXA9 MISSION shRNA shRNA Plasmid DNA
annexin A9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-1277s1c1
Sequence:CCGGCCCAATTACCAAGTCCTGATTCTCGAGAATCAGGACTTGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-868s1c1
Sequence:CCGGCCTGGCAGTCTACAAACACAACTCGAGTTGTGTTTGTAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-998s1c1
Sequence:CCGGGACTATAATCTGGCAGAACAACTCGAGTTGTTCTGCCAGATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-643s1c1
Sequence:CCGGGCAGCTCATCTCACGAAACTTCTCGAGAAGTTTCGTGAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-517s1c1
Sequence:CCGGCCTCAGGACCTTCTTGAACTTCTCGAGAAGTTCAAGAAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003568.2-816s21c1
Sequence:CCGGCAGTTTGACGCCCAGGAATTGCTCGAGCAATTCCTGGGCGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003568.2-1542s21c1
Sequence:CCGGGATCTGAGATTTCCGTGTTTGCTCGAGCAAACACGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003568
ANXA9 MISSION shRNA Lentiviral Transduction Particles
annexin A9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-1277s1c1
Sequence:CCGGCCCAATTACCAAGTCCTGATTCTCGAGAATCAGGACTTGGTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-868s1c1
Sequence:CCGGCCTGGCAGTCTACAAACACAACTCGAGTTGTGTTTGTAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-998s1c1
Sequence:CCGGGACTATAATCTGGCAGAACAACTCGAGTTGTTCTGCCAGATTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-643s1c1
Sequence:CCGGGCAGCTCATCTCACGAAACTTCTCGAGAAGTTTCGTGAGATGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003568.1-517s1c1
Sequence:CCGGCCTCAGGACCTTCTTGAACTTCTCGAGAAGTTCAAGAAGGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003568.2-816s21c1
Sequence:CCGGCAGTTTGACGCCCAGGAATTGCTCGAGCAATTCCTGGGCGTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003568.2-1542s21c1
Sequence:CCGGGATCTGAGATTTCCGTGTTTGCTCGAGCAAACACGGAAATCTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023628
VALIDATED
ANXA9 MISSION shRNA Bacterial Glycerol Stock
annexin A9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-1552s1c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-175s1c1
Sequence:CCGGCCTCAGGACGTTCTTGAGTTTCTCGAGAAACTCAAGAACGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-862s1c1
Sequence:CCGGCCTAGCTTCCATGTTGAGAAACTCGAGTTTCTCAACATGGAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-631s1c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-887s1c1
Sequence:CCGGGCGCTGTACTTTGCTAACAAACTCGAGTTTGTTAGCAAAGTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-1598s21c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-565s21c1
Sequence:CCGGAGGCATGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-968s21c1
Sequence:CCGGTCAGGAAACTGAGCCTAATTTCTCGAGAAATTAGGCTCAGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-375s21c1
Sequence:CCGGCGCACCAAACAGGATCTATTGCTCGAGCAATAGATCCTGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-677s21c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023628
VALIDATED
ANXA9 MISSION shRNA shRNA Plasmid DNA
annexin A9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-1552s1c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-175s1c1
Sequence:CCGGCCTCAGGACGTTCTTGAGTTTCTCGAGAAACTCAAGAACGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-862s1c1
Sequence:CCGGCCTAGCTTCCATGTTGAGAAACTCGAGTTTCTCAACATGGAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-631s1c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-887s1c1
Sequence:CCGGGCGCTGTACTTTGCTAACAAACTCGAGTTTGTTAGCAAAGTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-1598s21c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-565s21c1
Sequence:CCGGAGGCATGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-968s21c1
Sequence:CCGGTCAGGAAACTGAGCCTAATTTCTCGAGAAATTAGGCTCAGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-375s21c1
Sequence:CCGGCGCACCAAACAGGATCTATTGCTCGAGCAATAGATCCTGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-677s21c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023628
VALIDATED
ANXA9 MISSION shRNA Lentiviral Transduction Particles
annexin A9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-1552s1c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-175s1c1
Sequence:CCGGCCTCAGGACGTTCTTGAGTTTCTCGAGAAACTCAAGAACGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-862s1c1
Sequence:CCGGCCTAGCTTCCATGTTGAGAAACTCGAGTTTCTCAACATGGAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023628.1-631s1c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023628.1-887s1c1
Sequence:CCGGGCGCTGTACTTTGCTAACAAACTCGAGTTTGTTAGCAAAGTACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-1598s21c1
Sequence:CCGGCCCAGGAAATCTCACGTAATTCTCGAGAATTACGTGAGATTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-565s21c1
Sequence:CCGGAGGCATGCCTGGCAGTATATACTCGAGTATATACTGCCAGGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-968s21c1
Sequence:CCGGTCAGGAAACTGAGCCTAATTTCTCGAGAAATTAGGCTCAGTTTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-375s21c1
Sequence:CCGGCGCACCAAACAGGATCTATTGCTCGAGCAATAGATCCTGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023628.2-677s21c1
Sequence:CCGGCCGTGAGAGCTATTCTGGAATCTCGAGATTCCAGAATAGCTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks