EMAIL THIS PAGE TO A FRIEND

AOAH

acyloxyacyl hydrolase (neutrophil)

96 Gene Product Result for
UniProtKB ID: P28039, A4D1Y5, B7Z490, Q53F13
Gene ID:
Human(313) Summary: This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Apr 2010]
Mouse(27052) acyloxyacyl hydrolase
Rat(498757) acyloxyacyl hydrolase (neutrophil)
chicken(420737) acyloxyacyl hydrolase (neutrophil)
cow(768208) acyloxyacyl hydrolase (neutrophil)
Horse(100055508) acyloxyacyl hydrolase (neutrophil)
domestic cat(101101376) acyloxyacyl hydrolase (neutrophil)
dog(482402) acyloxyacyl hydrolase (neutrophil)
naked mole-rat(101718171) acyloxyacyl hydrolase (neutrophil)
domestic guinea pig(100714206) acyloxyacyl hydrolase (neutrophil)
sheep(101115787) acyloxyacyl hydrolase (neutrophil)
Domestic Rabbit(100008662) acyloxyacyl hydrolase (neutrophil)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001637 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020701 MISSION® esiRNA esiRNA human AOAH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001637 Rosetta Predictions human pricing
XM_001059259 Rosetta Predictions rat pricing
XM_574041 Rosetta Predictions rat pricing
NM_012054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097828 predicted 1232
2 SASI_Hs01_00097832 predicted 1476
3 SASI_Hs01_00097833 predicted 1664
4 SASI_Hs01_00097834 predicted 1454
5 SASI_Hs01_00097835 predicted 1422
6 SASI_Hs01_00097836 predicted 1561
7 SASI_Hs02_00332226 predicted 1115
8 SASI_Hs01_00097837 predicted 1055
9 SASI_Hs02_00332227 predicted 1486
10 SASI_Hs02_00332228 predicted 1459
11 SASI_Hs01_00097829 predicted 627
12 SASI_Hs01_00097830 predicted 691
13 SASI_Hs01_00097831 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292638 predicted 1246
2 SASI_Rn02_00292639 predicted 1202
3 SASI_Rn02_00292640 predicted 409
4 SASI_Rn02_00292641 predicted 1527
5 SASI_Rn02_00292642 predicted 931
6 SASI_Rn02_00292643 predicted 961
7 SASI_Rn02_00292644 predicted 1694
8 SASI_Rn02_00292645 predicted 1425
9 SASI_Rn02_00292646 predicted 453
10 SASI_Rn02_00292647 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401244 predicted 1178
2 SASI_Rn02_00401245 predicted 1128
3 SASI_Rn02_00401246 predicted 339
4 SASI_Rn02_00401247 predicted 1449
5 SASI_Rn02_00401248 predicted 861
6 SASI_Rn02_00401249 predicted 896
7 SASI_Rn02_00401250 predicted 1200
8 SASI_Rn02_00401251 predicted 1349
9 SASI_Rn02_00401252 predicted 382
10 SASI_Rn02_00401253 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189009 predicted 1353
2 SASI_Mm01_00189010 predicted 583
3 SASI_Mm01_00189011 predicted 1170
4 SASI_Mm01_00189012 predicted 529
5 SASI_Mm01_00189013 predicted 1744
6 SASI_Mm01_00189014 predicted 1880
7 SASI_Mm01_00189015 predicted 1697
8 SASI_Mm01_00189016 predicted 1375
9 SASI_Mm01_00189017 predicted 1601
10 SASI_Mm01_00189018 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012054
AOAH MISSION shRNA Bacterial Glycerol Stock
acyloxyacyl hydrolase (neutrophil)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012054.3-1571s21c1
Sequence:CCGGCCCTCTAGGCCAGCTAAATAACTCGAGTTATTTAGCTGGCCTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012054.3-2369s21c1
Sequence:CCGGTAGGCATGTGTAGGTTATATACTCGAGTATATAACCTACACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012054.2-2608s1c1
Sequence:CCGGGCCACAGATTTAGGGTTCAATCTCGAGATTGAACCCTAAATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1947s1c1
Sequence:CCGGGAATCCATTCAACTCTCAGATCTCGAGATCTGAGAGTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1379s1c1
Sequence:CCGGCCATGATTGGAAACGATGTTTCTCGAGAAACATCGTTTCCAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1464s1c1
Sequence:CCGGGCAGACTCTGACACATCTAAACTCGAGTTTAGATGTGTCAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-808s1c1
Sequence:CCGGGCCGTGCCATTCAAAGACATACTCGAGTATGTCTTTGAATGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012054
AOAH MISSION shRNA shRNA Plasmid DNA
acyloxyacyl hydrolase (neutrophil)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012054.3-1571s21c1
Sequence:CCGGCCCTCTAGGCCAGCTAAATAACTCGAGTTATTTAGCTGGCCTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012054.3-2369s21c1
Sequence:CCGGTAGGCATGTGTAGGTTATATACTCGAGTATATAACCTACACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012054.2-2608s1c1
Sequence:CCGGGCCACAGATTTAGGGTTCAATCTCGAGATTGAACCCTAAATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1947s1c1
Sequence:CCGGGAATCCATTCAACTCTCAGATCTCGAGATCTGAGAGTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1379s1c1
Sequence:CCGGCCATGATTGGAAACGATGTTTCTCGAGAAACATCGTTTCCAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1464s1c1
Sequence:CCGGGCAGACTCTGACACATCTAAACTCGAGTTTAGATGTGTCAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-808s1c1
Sequence:CCGGGCCGTGCCATTCAAAGACATACTCGAGTATGTCTTTGAATGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012054
AOAH MISSION shRNA Lentiviral Transduction Particles
acyloxyacyl hydrolase (neutrophil)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012054.3-1571s21c1
Sequence:CCGGCCCTCTAGGCCAGCTAAATAACTCGAGTTATTTAGCTGGCCTAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012054.3-2369s21c1
Sequence:CCGGTAGGCATGTGTAGGTTATATACTCGAGTATATAACCTACACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012054.2-2608s1c1
Sequence:CCGGGCCACAGATTTAGGGTTCAATCTCGAGATTGAACCCTAAATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1947s1c1
Sequence:CCGGGAATCCATTCAACTCTCAGATCTCGAGATCTGAGAGTTGAATGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1379s1c1
Sequence:CCGGCCATGATTGGAAACGATGTTTCTCGAGAAACATCGTTTCCAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-1464s1c1
Sequence:CCGGGCAGACTCTGACACATCTAAACTCGAGTTTAGATGTGTCAGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012054.2-808s1c1
Sequence:CCGGGCCGTGCCATTCAAAGACATACTCGAGTATGTCTTTGAATGGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001637
AOAH MISSION shRNA Bacterial Glycerol Stock
acyloxyacyl hydrolase (neutrophil)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1483s21c1
Sequence:CCGGACTATCCCGCCATCGTTATATCTCGAGATATAACGATGGCGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1594s21c1
Sequence:CCGGAGACTCTGAAGCATCTAAATTCTCGAGAATTTAGATGCTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1579s1c1
Sequence:CCGGCGGCCAGCTAAATAAAGACATCTCGAGATGTCTTTATTTAGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-946s1c1
Sequence:CCGGCCATCAGGATTCAAACTGTAACTCGAGTTACAGTTTGAATCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1609s1c1
Sequence:CCGGGCAGTTGTACTCCTTCCTGAACTCGAGTTCAGGAAGGAGTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-631s1c1
Sequence:CCGGCCAACCATTGTGTCATCTCTACTCGAGTAGAGATGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1108s1c1
Sequence:CCGGGCAGATGTCTTTGAACTCTTTCTCGAGAAAGAGTTCAAAGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001637
AOAH MISSION shRNA shRNA Plasmid DNA
acyloxyacyl hydrolase (neutrophil)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1483s21c1
Sequence:CCGGACTATCCCGCCATCGTTATATCTCGAGATATAACGATGGCGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1594s21c1
Sequence:CCGGAGACTCTGAAGCATCTAAATTCTCGAGAATTTAGATGCTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1579s1c1
Sequence:CCGGCGGCCAGCTAAATAAAGACATCTCGAGATGTCTTTATTTAGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-946s1c1
Sequence:CCGGCCATCAGGATTCAAACTGTAACTCGAGTTACAGTTTGAATCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1609s1c1
Sequence:CCGGGCAGTTGTACTCCTTCCTGAACTCGAGTTCAGGAAGGAGTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-631s1c1
Sequence:CCGGCCAACCATTGTGTCATCTCTACTCGAGTAGAGATGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1108s1c1
Sequence:CCGGGCAGATGTCTTTGAACTCTTTCTCGAGAAAGAGTTCAAAGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001637
AOAH MISSION shRNA Lentiviral Transduction Particles
acyloxyacyl hydrolase (neutrophil)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1483s21c1
Sequence:CCGGACTATCCCGCCATCGTTATATCTCGAGATATAACGATGGCGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001637.2-1594s21c1
Sequence:CCGGAGACTCTGAAGCATCTAAATTCTCGAGAATTTAGATGCTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1579s1c1
Sequence:CCGGCGGCCAGCTAAATAAAGACATCTCGAGATGTCTTTATTTAGCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-946s1c1
Sequence:CCGGCCATCAGGATTCAAACTGTAACTCGAGTTACAGTTTGAATCCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1609s1c1
Sequence:CCGGGCAGTTGTACTCCTTCCTGAACTCGAGTTCAGGAAGGAGTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-631s1c1
Sequence:CCGGCCAACCATTGTGTCATCTCTACTCGAGTAGAGATGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001637.1-1108s1c1
Sequence:CCGGGCAGATGTCTTTGAACTCTTTCTCGAGAAAGAGTTCAAAGACATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks