EMAIL THIS PAGE TO A FRIEND

AOC1

amine oxidase, copper containing 1

Synonyms: ABP ABP1 DAO DAO1 KAO
Species: Human AOC1(26), Mouse Aoc1(76507), Rat Aoc1(65029), Zebrafish aoc1(555401), Thale Cress AOC1(822167), domestic guinea pig Aoc1(100735646)
Gene ID:
Human(26) Summary: This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Mouse(76507) amine oxidase, copper-containing 1
Rat(65029) amine oxidase, copper containing 1
Zebrafish(555401) amine oxidase, copper containing 1
Thale Cress(822167) allene oxide cyclase 1
domestic guinea pig(100735646) amine oxidase, copper containing 1
Gene Class: ATPase
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7410 Amiloride hydrochloride hydrate ≥98% (TLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001091 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117101 MISSION® esiRNA esiRNA human ABP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001091 Rosetta Predictions human pricing
NM_022935 Rosetta Predictions rat pricing
NM_029638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212261 predicted 520
2 SASI_Hs01_00212262 predicted 1452
3 SASI_Hs01_00212263 predicted 2182
4 SASI_Hs01_00212264 predicted 1450
5 SASI_Hs01_00212265 predicted 701
6 SASI_Hs01_00212267 predicted 1470
7 SASI_Hs01_00212268 predicted 573
8 SASI_Hs01_00212269 predicted 317
9 SASI_Hs01_00212270 predicted 797
10 SASI_Hs02_00318088 predicted 1129
11 SASI_Hs01_00212266 predicted 2032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263638 predicted 809
2 SASI_Rn01_00093213 predicted 554
3 SASI_Rn01_00093215 predicted 1639
4 SASI_Rn02_00263639 predicted 304
5 SASI_Rn01_00093216 predicted 2230
6 SASI_Rn01_00093217 predicted 420
7 SASI_Rn01_00093219 predicted 1860
8 SASI_Rn02_00263640 predicted 1093
9 SASI_Rn01_00093220 predicted 1188
10 SASI_Rn02_00263641 predicted 2301
11 SASI_Rn01_00093214 predicted 694
12 SASI_Rn01_00093218 predicted 1931
13 SASI_Rn01_00093221 predicted 670
14 SASI_Rn01_00093222 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084216 predicted 2122
2 SASI_Mm01_00084217 predicted 1377
3 SASI_Mm01_00084218 predicted 1932
4 SASI_Mm01_00084219 predicted 464
5 SASI_Mm01_00084220 predicted 1067
6 SASI_Mm01_00084221 predicted 1223
7 SASI_Mm01_00084222 predicted 654
8 SASI_Mm01_00084223 predicted 2126
9 SASI_Mm01_00084224 predicted 1428
10 SASI_Mm02_00335632 predicted 1131
11 SASI_Mm01_00084215 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029638
AOC1 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029638.1-2505s1c1
Sequence:CCGGGCAAAGGAAGATCACAGAATTCTCGAGAATTCTGTGATCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1931s1c1
Sequence:CCGGGCTGTGACAAAGTATCGGGAACTCGAGTTCCCGATACTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-140s1c1
Sequence:CCGGCCTCATGACAAAGCAAGGATACTCGAGTATCCTTGCTTTGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1350s1c1
Sequence:CCGGGCCACTTTGACTCAAACTTTACTCGAGTAAAGTTTGAGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1349s1c2
Sequence:CCGGCGCCACTTTGACTCAAACTTTCTCGAGAAAGTTTGAGTCAAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029638
AOC1 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029638.1-2505s1c1
Sequence:CCGGGCAAAGGAAGATCACAGAATTCTCGAGAATTCTGTGATCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1931s1c1
Sequence:CCGGGCTGTGACAAAGTATCGGGAACTCGAGTTCCCGATACTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-140s1c1
Sequence:CCGGCCTCATGACAAAGCAAGGATACTCGAGTATCCTTGCTTTGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1350s1c1
Sequence:CCGGGCCACTTTGACTCAAACTTTACTCGAGTAAAGTTTGAGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1349s1c2
Sequence:CCGGCGCCACTTTGACTCAAACTTTCTCGAGAAAGTTTGAGTCAAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029638
AOC1 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029638.1-2505s1c1
Sequence:CCGGGCAAAGGAAGATCACAGAATTCTCGAGAATTCTGTGATCTTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1931s1c1
Sequence:CCGGGCTGTGACAAAGTATCGGGAACTCGAGTTCCCGATACTTTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-140s1c1
Sequence:CCGGCCTCATGACAAAGCAAGGATACTCGAGTATCCTTGCTTTGTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1350s1c1
Sequence:CCGGGCCACTTTGACTCAAACTTTACTCGAGTAAAGTTTGAGTCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029638.1-1349s1c2
Sequence:CCGGCGCCACTTTGACTCAAACTTTCTCGAGAAAGTTTGAGTCAAAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001091
AOC1 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-1427s1c1
Sequence:CCGGGCGGACAACTTCAACTGTCTACTCGAGTAGACAGTTGAAGTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-684s1c1
Sequence:CCGGCGCTATGTAGAAGGCTACTTTCTCGAGAAAGTAGCCTTCTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-2013s1c1
Sequence:CCGGGTGGTCTTTGAGCAGTTTCTTCTCGAGAAGAAACTGCTCAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-176s1c1
Sequence:CCGGCCTAAGCAACCAAGAGCTGAACTCGAGTTCAGCTCTTGGTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-281s21c1
Sequence:CCGGTGGCCAAGAACACCGTGTTTCCTCGAGGAAACACGGTGTTCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-413s21c1
Sequence:CCGGATCCCAATGTCACCGAGTTTGCTCGAGCAAACTCGGTGACATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-830s21c1
Sequence:CCGGAGGAACTGGCTCGGAAGTATGCTCGAGCATACTTCCGAGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001091
AOC1 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-1427s1c1
Sequence:CCGGGCGGACAACTTCAACTGTCTACTCGAGTAGACAGTTGAAGTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-684s1c1
Sequence:CCGGCGCTATGTAGAAGGCTACTTTCTCGAGAAAGTAGCCTTCTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-2013s1c1
Sequence:CCGGGTGGTCTTTGAGCAGTTTCTTCTCGAGAAGAAACTGCTCAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-176s1c1
Sequence:CCGGCCTAAGCAACCAAGAGCTGAACTCGAGTTCAGCTCTTGGTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-281s21c1
Sequence:CCGGTGGCCAAGAACACCGTGTTTCCTCGAGGAAACACGGTGTTCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-413s21c1
Sequence:CCGGATCCCAATGTCACCGAGTTTGCTCGAGCAAACTCGGTGACATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-830s21c1
Sequence:CCGGAGGAACTGGCTCGGAAGTATGCTCGAGCATACTTCCGAGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001091
AOC1 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-1427s1c1
Sequence:CCGGGCGGACAACTTCAACTGTCTACTCGAGTAGACAGTTGAAGTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-684s1c1
Sequence:CCGGCGCTATGTAGAAGGCTACTTTCTCGAGAAAGTAGCCTTCTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-2013s1c1
Sequence:CCGGGTGGTCTTTGAGCAGTTTCTTCTCGAGAAGAAACTGCTCAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001091.1-176s1c1
Sequence:CCGGCCTAAGCAACCAAGAGCTGAACTCGAGTTCAGCTCTTGGTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-281s21c1
Sequence:CCGGTGGCCAAGAACACCGTGTTTCCTCGAGGAAACACGGTGTTCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-413s21c1
Sequence:CCGGATCCCAATGTCACCGAGTTTGCTCGAGCAAACTCGGTGACATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001091.2-830s21c1
Sequence:CCGGAGGAACTGGCTCGGAAGTATGCTCGAGCATACTTCCGAGCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks