EMAIL THIS PAGE TO A FRIEND

AOC2

amine oxidase, copper containing 2 (retina-specific)

44 Gene Product Result for
Synonyms: DAO2 RAO
UniProtKB ID: O75106, A5PKW2, O00120, O75105, Q4TTW5, Q9UNY0
Gene ID:
Human(314) Summary: Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(237940) amine oxidase, copper containing 2 (retina-specific)
sheep(101106783) amine oxidase, copper containing 2 (retina-specific)
Domestic Rabbit(100353051) amine oxidase, copper containing 2 (retina-specific)
Thale Cress(822168) allene oxide cyclase 2
domestic cat(101080592) amine oxidase, copper containing 2 (retina-specific)
cow(100336082) amine oxidase, copper containing 2 (retina-specific)
dog(490957) amine oxidase, copper containing 2 (retina-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001158 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001158 Rosetta Predictions human pricing
NM_009590 Rosetta Predictions human pricing
NM_178932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110749 predicted 1084
2 SASI_Hs01_00110750 predicted 972
3 SASI_Hs01_00110751 predicted 1035
4 SASI_Hs01_00110752 predicted 1404
5 SASI_Hs01_00110753 predicted 1461
6 SASI_Hs01_00110754 predicted 1004
7 SASI_Hs01_00110755 predicted 850
8 SASI_Hs01_00110756 predicted 1160
9 SASI_Hs01_00110757 predicted 1408
10 SASI_Hs01_00110758 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110450 predicted 1086
2 SASI_Hs01_00110451 predicted 972
3 SASI_Hs01_00110452 predicted 1036
4 SASI_Hs01_00110453 predicted 1411
5 SASI_Hs01_00110454 predicted 1465
6 SASI_Hs01_00110455 predicted 997
7 SASI_Hs01_00110456 predicted 849
8 SASI_Hs01_00110457 predicted 1165
9 SASI_Hs01_00110458 predicted 1412
10 SASI_Hs01_00110459 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048533 predicted 972
2 SASI_Mm01_00048534 predicted 1401
3 SASI_Mm01_00048535 predicted 1635
4 SASI_Mm01_00048536 predicted 1953
5 SASI_Mm01_00048537 predicted 2295
6 SASI_Mm01_00048538 predicted 2112
7 SASI_Mm01_00048539 predicted 641
8 SASI_Mm01_00048540 predicted 1087
9 SASI_Mm01_00048541 predicted 817
10 SASI_Mm01_00048542 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178932
AOC2 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 2 (retina-specific)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178932.1-2402s1c2
Sequence:CCGGCCTGAGTTCAATTCCCTGCAACTCGAGTTGCAGGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-977s1c1
Sequence:CCGGCCCAGTATAACATACAGGGAACTCGAGTTCCCTGTATGTTATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-645s1c1
Sequence:CCGGGCATTCTACTGCTAGTGGTTTCTCGAGAAACCACTAGCAGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1110s1c1
Sequence:CCGGCCAGGAGTGTCTGACAGTTTACTCGAGTAAACTGTCAGACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1608s1c1
Sequence:CCGGCCTTGATGTAGCAGGTTTGAACTCGAGTTCAAACCTGCTACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178932
AOC2 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 2 (retina-specific)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178932.1-2402s1c2
Sequence:CCGGCCTGAGTTCAATTCCCTGCAACTCGAGTTGCAGGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-977s1c1
Sequence:CCGGCCCAGTATAACATACAGGGAACTCGAGTTCCCTGTATGTTATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-645s1c1
Sequence:CCGGGCATTCTACTGCTAGTGGTTTCTCGAGAAACCACTAGCAGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1110s1c1
Sequence:CCGGCCAGGAGTGTCTGACAGTTTACTCGAGTAAACTGTCAGACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1608s1c1
Sequence:CCGGCCTTGATGTAGCAGGTTTGAACTCGAGTTCAAACCTGCTACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178932
AOC2 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 2 (retina-specific)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178932.1-2402s1c2
Sequence:CCGGCCTGAGTTCAATTCCCTGCAACTCGAGTTGCAGGGAATTGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-977s1c1
Sequence:CCGGCCCAGTATAACATACAGGGAACTCGAGTTCCCTGTATGTTATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-645s1c1
Sequence:CCGGGCATTCTACTGCTAGTGGTTTCTCGAGAAACCACTAGCAGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1110s1c1
Sequence:CCGGCCAGGAGTGTCTGACAGTTTACTCGAGTAAACTGTCAGACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178932.1-1608s1c1
Sequence:CCGGCCTTGATGTAGCAGGTTTGAACTCGAGTTCAAACCTGCTACATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001158
VALIDATED
AOC2 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 2 (retina-specific)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-615s1c1
Sequence:CCGGCCTTCAACTACAATGGCTCTACTCGAGTAGAGCCATTGTAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1640s1c1
Sequence:CCGGGTAGCTGAAGACGTGGTGTTTCTCGAGAAACACCACGTCTTCAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-1491s1c1
Sequence:CCGGCGGGTTATATCAACACAGCTTCTCGAGAAGCTGTGTTGATATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-68s1c1
Sequence:CCGGCTGTCCCTCATTACCATCTTTCTCGAGAAAGATGGTAATGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1163s1c1
Sequence:CCGGCGCTATTTGGATAGCAGCTTTCTCGAGAAAGCTGCTATCCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001158
VALIDATED
AOC2 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 2 (retina-specific)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-615s1c1
Sequence:CCGGCCTTCAACTACAATGGCTCTACTCGAGTAGAGCCATTGTAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1640s1c1
Sequence:CCGGGTAGCTGAAGACGTGGTGTTTCTCGAGAAACACCACGTCTTCAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-1491s1c1
Sequence:CCGGCGGGTTATATCAACACAGCTTCTCGAGAAGCTGTGTTGATATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-68s1c1
Sequence:CCGGCTGTCCCTCATTACCATCTTTCTCGAGAAAGATGGTAATGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1163s1c1
Sequence:CCGGCGCTATTTGGATAGCAGCTTTCTCGAGAAAGCTGCTATCCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001158
VALIDATED
AOC2 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 2 (retina-specific)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-615s1c1
Sequence:CCGGCCTTCAACTACAATGGCTCTACTCGAGTAGAGCCATTGTAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1640s1c1
Sequence:CCGGGTAGCTGAAGACGTGGTGTTTCTCGAGAAACACCACGTCTTCAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-1491s1c1
Sequence:CCGGCGGGTTATATCAACACAGCTTCTCGAGAAGCTGTGTTGATATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001158.2-68s1c1
Sequence:CCGGCTGTCCCTCATTACCATCTTTCTCGAGAAAGATGGTAATGAGGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001158.2-1163s1c1
Sequence:CCGGCGCTATTTGGATAGCAGCTTTCTCGAGAAAGCTGCTATCCAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks