EMAIL THIS PAGE TO A FRIEND

AOC3

amine oxidase, copper containing 3

70 Gene Product Result for
Synonyms: HPAO SSAO VAP-1 VAP1
UniProtKB ID: Q16853, B2RCI5, Q45F94
Gene ID:
Human(8639) Summary: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Mouse(11754) amine oxidase, copper containing 3
Rat(29473) amine oxidase, copper containing 3
domestic guinea pig(100721976) amine oxidase, copper containing 3
naked mole-rat(101709673) amine oxidase, copper containing 3
sheep(101112335) amine oxidase, copper containing 3 (vascular adhesion protein 1)
Thale Cress(822169) allene oxide cyclase 3
cow(281002) amine oxidase, copper containing 3 (vascular adhesion protein 1)
Horse(100065718) amine oxidase, copper containing 3 (vascular adhesion protein 1)
chicken(420015) amine oxidase, copper containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1772 Human VAP-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003734 Rosetta Predictions human pricing
NM_031582 Rosetta Predictions rat pricing
NM_009675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074831 predicted 1212
2 SASI_Hs01_00074832 predicted 1423
3 SASI_Hs02_00336184 predicted 1181
4 SASI_Hs02_00336185 predicted 1227
5 SASI_Hs02_00336186 predicted 2276
6 SASI_Hs01_00074834 predicted 1622
7 SASI_Hs01_00074835 predicted 1304
8 SASI_Hs01_00074836 predicted 2152
9 SASI_Hs01_00074839 predicted 929
10 SASI_Hs01_00074840 predicted 1541
11 SASI_Hs01_00074833 predicted 1499
12 SASI_Hs01_00074837 predicted 1730
13 SASI_Hs01_00074838 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053740 predicted 1894
2 SASI_Rn01_00053741 predicted 1548
3 SASI_Rn01_00053742 predicted 1487
4 SASI_Rn01_00053743 predicted 2350
5 SASI_Rn01_00053745 predicted 2005
6 SASI_Rn02_00264844 predicted 1102
7 SASI_Rn01_00053746 predicted 1847
8 SASI_Rn01_00053747 predicted 805
9 SASI_Rn01_00053748 predicted 872
10 SASI_Rn02_00264845 predicted 659
11 SASI_Rn01_00053744 predicted 294
12 SASI_Rn01_00053749 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316724 predicted 1557
2 SASI_Mm02_00316725 predicted 2462
3 SASI_Mm02_00316726 predicted 1739
4 SASI_Mm02_00316727 predicted 1825
5 SASI_Mm02_00316728 predicted 1209
6 SASI_Mm02_00316729 predicted 1615
7 SASI_Mm02_00316730 predicted 1138
8 SASI_Mm02_00316731 predicted 1793
9 SASI_Mm02_00316732 predicted 2194
10 SASI_Mm02_00316733 predicted 2162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009675
AOC3 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009675.1-2971s1c1
Sequence:CCGGGCCTGGAGTAATGGCTATGTTCTCGAGAACATAGCCATTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1741s1c1
Sequence:CCGGCGTGTCTACCTTGCTCAATTACTCGAGTAATTGAGCAAGGTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-2467s1c1
Sequence:CCGGGCCGTATAACTTCTTTGACGACTCGAGTCGTCAAAGAAGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1207s1c1
Sequence:CCGGGAATGTGGTATTGGTCCCAAACTCGAGTTTGGGACCAATACCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-934s1c1
Sequence:CCGGCCATCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1069s21c1
Sequence:CCGGGGAGCTTCTGATAGATCATAACTCGAGTTATGATCTATCAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1668s21c1
Sequence:CCGGCAGATTTCTACTCCCATTATTCTCGAGAATAATGGGAGTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009675
AOC3 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009675.1-2971s1c1
Sequence:CCGGGCCTGGAGTAATGGCTATGTTCTCGAGAACATAGCCATTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1741s1c1
Sequence:CCGGCGTGTCTACCTTGCTCAATTACTCGAGTAATTGAGCAAGGTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-2467s1c1
Sequence:CCGGGCCGTATAACTTCTTTGACGACTCGAGTCGTCAAAGAAGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1207s1c1
Sequence:CCGGGAATGTGGTATTGGTCCCAAACTCGAGTTTGGGACCAATACCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-934s1c1
Sequence:CCGGCCATCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1069s21c1
Sequence:CCGGGGAGCTTCTGATAGATCATAACTCGAGTTATGATCTATCAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1668s21c1
Sequence:CCGGCAGATTTCTACTCCCATTATTCTCGAGAATAATGGGAGTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009675
AOC3 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009675.1-2971s1c1
Sequence:CCGGGCCTGGAGTAATGGCTATGTTCTCGAGAACATAGCCATTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1741s1c1
Sequence:CCGGCGTGTCTACCTTGCTCAATTACTCGAGTAATTGAGCAAGGTAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-2467s1c1
Sequence:CCGGGCCGTATAACTTCTTTGACGACTCGAGTCGTCAAAGAAGTTATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-1207s1c1
Sequence:CCGGGAATGTGGTATTGGTCCCAAACTCGAGTTTGGGACCAATACCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009675.1-934s1c1
Sequence:CCGGCCATCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1069s21c1
Sequence:CCGGGGAGCTTCTGATAGATCATAACTCGAGTTATGATCTATCAGAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009675.2-1668s21c1
Sequence:CCGGCAGATTTCTACTCCCATTATTCTCGAGAATAATGGGAGTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003734
AOC3 MISSION shRNA Bacterial Glycerol Stock
amine oxidase, copper containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1610s1c1
Sequence:CCGGGCCATAGAAATACGATTCTATCTCGAGATAGAATCGTATTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1217s1c1
Sequence:CCGGCGCTTCCAAGGAGAAAGACTACTCGAGTAGTCTTTCTCCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-204s1c1
Sequence:CCGGTCACCATCTTTGCCTTGGTTTCTCGAGAAACCAAGGCAAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-688s1c1
Sequence:CCGGCCTGGACATAGACCAGATGATCTCGAGATCATCTGGTCTATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-745s1c1
Sequence:CCGGCCACCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2866s21c1
Sequence:CCGGAGGATGCTTCTGCTCACATTCCTCGAGGAATGTGAGCAGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2778s21c1
Sequence:CCGGGCCACCTCCAAGGACTCTAAACTCGAGTTTAGAGTCCTTGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-1554s21c1
Sequence:CCGGTGTCCACCTTGCTCAACTATGCTCGAGCATAGTTGAGCAAGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-195s21c1
Sequence:CCGGTGGCCGTCATCACCATCTTTGCTCGAGCAAAGATGGTGATGACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003734
AOC3 MISSION shRNA shRNA Plasmid DNA
amine oxidase, copper containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1610s1c1
Sequence:CCGGGCCATAGAAATACGATTCTATCTCGAGATAGAATCGTATTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1217s1c1
Sequence:CCGGCGCTTCCAAGGAGAAAGACTACTCGAGTAGTCTTTCTCCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-204s1c1
Sequence:CCGGTCACCATCTTTGCCTTGGTTTCTCGAGAAACCAAGGCAAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-688s1c1
Sequence:CCGGCCTGGACATAGACCAGATGATCTCGAGATCATCTGGTCTATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-745s1c1
Sequence:CCGGCCACCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2866s21c1
Sequence:CCGGAGGATGCTTCTGCTCACATTCCTCGAGGAATGTGAGCAGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2778s21c1
Sequence:CCGGGCCACCTCCAAGGACTCTAAACTCGAGTTTAGAGTCCTTGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-1554s21c1
Sequence:CCGGTGTCCACCTTGCTCAACTATGCTCGAGCATAGTTGAGCAAGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-195s21c1
Sequence:CCGGTGGCCGTCATCACCATCTTTGCTCGAGCAAAGATGGTGATGACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003734
AOC3 MISSION shRNA Lentiviral Transduction Particles
amine oxidase, copper containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1610s1c1
Sequence:CCGGGCCATAGAAATACGATTCTATCTCGAGATAGAATCGTATTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-1217s1c1
Sequence:CCGGCGCTTCCAAGGAGAAAGACTACTCGAGTAGTCTTTCTCCTTGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-204s1c1
Sequence:CCGGTCACCATCTTTGCCTTGGTTTCTCGAGAAACCAAGGCAAAGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-688s1c1
Sequence:CCGGCCTGGACATAGACCAGATGATCTCGAGATCATCTGGTCTATGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003734.2-745s1c1
Sequence:CCGGCCACCACTGTTGCTTCTACAACTCGAGTTGTAGAAGCAACAGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2866s21c1
Sequence:CCGGAGGATGCTTCTGCTCACATTCCTCGAGGAATGTGAGCAGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003734.2-2778s21c1
Sequence:CCGGGCCACCTCCAAGGACTCTAAACTCGAGTTTAGAGTCCTTGGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-1554s21c1
Sequence:CCGGTGTCCACCTTGCTCAACTATGCTCGAGCATAGTTGAGCAAGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003734.2-195s21c1
Sequence:CCGGTGGCCGTCATCACCATCTTTGCTCGAGCAAAGATGGTGATGACGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks