EMAIL THIS PAGE TO A FRIEND

AOX1

aldehyde oxidase 1

Synonyms: AO AOH1
UniProtKB ID: Q06278, O14765, Q53RR8, Q53TV3, Q9BYF0, Q9UPG6
Gene ID:
Human(316) Summary: Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Mouse(11761) aldehyde oxidase 1
Rat(54349) aldehyde oxidase 1
Zebrafish(570457) aldehyde oxidase 1
cow(338074) aldehyde oxidase 1
Horse(100147243) aldehyde oxidase 1
Horse(100070976) aldehyde oxidase 1
dog(608820) aldehyde oxidase 1 pseudogene
chicken(424071) aldehyde oxidase 1
naked mole-rat(101722898) aldehyde oxidase 1
domestic guinea pig(100714172) aldehyde oxidase 1
Domestic Rabbit(100008601) aldehyde oxidase 1
Gene Class: Dehydrogenase
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009676 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009676 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009676 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001159 Rosetta Predictions human pricing
NM_019363 Rosetta Predictions rat pricing
NM_009676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221862 predicted 2171
2 SASI_Hs02_00331271 predicted 1451
3 SASI_Hs01_00221863 predicted 1963
4 SASI_Hs01_00221864 predicted 3699
5 SASI_Hs01_00221865 predicted 2891
6 SASI_Hs02_00331272 predicted 2234
7 SASI_Hs01_00221867 predicted 257
8 SASI_Hs02_00331273 predicted 2999
9 SASI_Hs01_00221868 predicted 3012
10 SASI_Hs01_00221869 predicted 3034
11 SASI_Hs01_00221866 predicted 2096
12 SASI_Hs01_00221870 predicted 2672
13 SASI_Hs01_00221871 predicted 2402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033193 predicted 2333
2 SASI_Rn01_00033194 predicted 2048
3 SASI_Rn01_00033196 predicted 1123
4 SASI_Rn01_00033197 predicted 2208
5 SASI_Rn01_00033198 predicted 2369
6 SASI_Rn01_00033199 predicted 505
7 SASI_Rn01_00033200 predicted 1684
8 SASI_Rn02_00262383 predicted 3814
9 SASI_Rn01_00033201 predicted 905
10 SASI_Rn02_00262384 predicted 2597
11 SASI_Rn01_00033192 predicted 3682
12 SASI_Rn01_00033195 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023609 predicted 1400
2 SASI_Mm01_00023610 predicted 4068
3 SASI_Mm01_00023611 predicted 3678
4 SASI_Mm02_00316734 predicted 1908
5 SASI_Mm01_00023612 predicted 689
6 SASI_Mm01_00023613 predicted 2678
7 SASI_Mm02_00316735 predicted 1912
8 SASI_Mm01_00023614 predicted 1213
9 SASI_Mm01_00023615 predicted 1358
10 SASI_Mm01_00023616 predicted 498
11 SASI_Mm01_00023617 predicted 3045
12 SASI_Mm01_00023618 predicted 4083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001159
AOX1 MISSION shRNA Bacterial Glycerol Stock
aldehyde oxidase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-1408s21c1
Sequence:CCGGATGCGCTAGCGATAGTCAATTCTCGAGAATTGACTATCGCTAGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-2202s21c1
Sequence:CCGGGAGCCGCTGATACTAACAATTCTCGAGAATTGTTAGTATCAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3903s1c1
Sequence:CCGGGCCAGATTGAAGGTGCATTTACTCGAGTAAATGCACCTTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-558s1c1
Sequence:CCGGCCACAGTAGAAGGCATAGGAACTCGAGTTCCTATGCCTTCTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-1913s1c1
Sequence:CCGGCCAGTTCACTATCCTAGCCTTCTCGAGAAGGCTAGGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3137s1c1
Sequence:CCGGCCTGAGAAGGTGCGAATCATACTCGAGTATGATTCGCACCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3478s1c1
Sequence:CCGGCCGTGAATTAAGAATGCCAATCTCGAGATTGGCATTCTTAATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001159
AOX1 MISSION shRNA shRNA Plasmid DNA
aldehyde oxidase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-1408s21c1
Sequence:CCGGATGCGCTAGCGATAGTCAATTCTCGAGAATTGACTATCGCTAGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-2202s21c1
Sequence:CCGGGAGCCGCTGATACTAACAATTCTCGAGAATTGTTAGTATCAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3903s1c1
Sequence:CCGGGCCAGATTGAAGGTGCATTTACTCGAGTAAATGCACCTTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-558s1c1
Sequence:CCGGCCACAGTAGAAGGCATAGGAACTCGAGTTCCTATGCCTTCTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-1913s1c1
Sequence:CCGGCCAGTTCACTATCCTAGCCTTCTCGAGAAGGCTAGGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3137s1c1
Sequence:CCGGCCTGAGAAGGTGCGAATCATACTCGAGTATGATTCGCACCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3478s1c1
Sequence:CCGGCCGTGAATTAAGAATGCCAATCTCGAGATTGGCATTCTTAATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001159
AOX1 MISSION shRNA Lentiviral Transduction Particles
aldehyde oxidase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-1408s21c1
Sequence:CCGGATGCGCTAGCGATAGTCAATTCTCGAGAATTGACTATCGCTAGCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001159.3-2202s21c1
Sequence:CCGGGAGCCGCTGATACTAACAATTCTCGAGAATTGTTAGTATCAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3903s1c1
Sequence:CCGGGCCAGATTGAAGGTGCATTTACTCGAGTAAATGCACCTTCAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-558s1c1
Sequence:CCGGCCACAGTAGAAGGCATAGGAACTCGAGTTCCTATGCCTTCTACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-1913s1c1
Sequence:CCGGCCAGTTCACTATCCTAGCCTTCTCGAGAAGGCTAGGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3137s1c1
Sequence:CCGGCCTGAGAAGGTGCGAATCATACTCGAGTATGATTCGCACCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001159.2-3478s1c1
Sequence:CCGGCCGTGAATTAAGAATGCCAATCTCGAGATTGGCATTCTTAATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009676
VALIDATED
AOX1 MISSION shRNA Bacterial Glycerol Stock
aldehyde oxidase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2905s21c1
Sequence:CCGGCACGTTGATACTACCCATTACCTCGAGGTAATGGGTAGTATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2875s21c1
Sequence:CCGGGAGCAGGTTCGAACCATAAATCTCGAGATTTATGGTTCGAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3853s21c1
Sequence:CCGGTTTCTGGGATGTTCGGTATTTCTCGAGAAATACCGAACATCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009676.2-4111s21c1
Sequence:CCGGTCTGCTCTAAGATGCTAAATGCTCGAGCATTTAGCATCTTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3438s21c1
Sequence:CCGGTCTCTCGGCTGTTGGATATTTCTCGAGAAATATCCAACAGCCGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009676.1-4157s1c1
Sequence:CCGGCGGAAGATTCTCTTGAGGATACTCGAGTATCCTCAAGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3041s1c1
Sequence:CCGGCCTGTGGGTATTGGATCAGTACTCGAGTACTGATCCAATACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3470s1c1
Sequence:CCGGCCCTTCGAATACTTTGTGTTTCTCGAGAAACACAAAGTATTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009676.1-475s1c1
Sequence:CCGGGCCCATAATTGATGCCTGCAACTCGAGTTGCAGGCATCAATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-546s1c1
Sequence:CCGGGCTGTTTGGATCAAGAAATAACTCGAGTTATTTCTTGATCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009676
VALIDATED
AOX1 MISSION shRNA shRNA Plasmid DNA
aldehyde oxidase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2905s21c1
Sequence:CCGGCACGTTGATACTACCCATTACCTCGAGGTAATGGGTAGTATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2875s21c1
Sequence:CCGGGAGCAGGTTCGAACCATAAATCTCGAGATTTATGGTTCGAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3853s21c1
Sequence:CCGGTTTCTGGGATGTTCGGTATTTCTCGAGAAATACCGAACATCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009676.2-4111s21c1
Sequence:CCGGTCTGCTCTAAGATGCTAAATGCTCGAGCATTTAGCATCTTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3438s21c1
Sequence:CCGGTCTCTCGGCTGTTGGATATTTCTCGAGAAATATCCAACAGCCGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009676.1-4157s1c1
Sequence:CCGGCGGAAGATTCTCTTGAGGATACTCGAGTATCCTCAAGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3041s1c1
Sequence:CCGGCCTGTGGGTATTGGATCAGTACTCGAGTACTGATCCAATACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3470s1c1
Sequence:CCGGCCCTTCGAATACTTTGTGTTTCTCGAGAAACACAAAGTATTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009676.1-475s1c1
Sequence:CCGGGCCCATAATTGATGCCTGCAACTCGAGTTGCAGGCATCAATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-546s1c1
Sequence:CCGGGCTGTTTGGATCAAGAAATAACTCGAGTTATTTCTTGATCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009676
VALIDATED
AOX1 MISSION shRNA Lentiviral Transduction Particles
aldehyde oxidase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2905s21c1
Sequence:CCGGCACGTTGATACTACCCATTACCTCGAGGTAATGGGTAGTATCAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-2875s21c1
Sequence:CCGGGAGCAGGTTCGAACCATAAATCTCGAGATTTATGGTTCGAACCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3853s21c1
Sequence:CCGGTTTCTGGGATGTTCGGTATTTCTCGAGAAATACCGAACATCCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009676.2-4111s21c1
Sequence:CCGGTCTGCTCTAAGATGCTAAATGCTCGAGCATTTAGCATCTTAGAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009676.2-3438s21c1
Sequence:CCGGTCTCTCGGCTGTTGGATATTTCTCGAGAAATATCCAACAGCCGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009676.1-4157s1c1
Sequence:CCGGCGGAAGATTCTCTTGAGGATACTCGAGTATCCTCAAGAGAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3041s1c1
Sequence:CCGGCCTGTGGGTATTGGATCAGTACTCGAGTACTGATCCAATACCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-3470s1c1
Sequence:CCGGCCCTTCGAATACTTTGTGTTTCTCGAGAAACACAAAGTATTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009676.1-475s1c1
Sequence:CCGGGCCCATAATTGATGCCTGCAACTCGAGTTGCAGGCATCAATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009676.1-546s1c1
Sequence:CCGGGCTGTTTGGATCAAGAAATAACTCGAGTTATTTCTTGATCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks