EMAIL THIS PAGE TO A FRIEND

AP1AR

adaptor-related protein complex 1 associated regulatory protein

126 Gene Product Result for
Synonyms: 2C18 C4orf16 GBAR gamma-BAR
UniProtKB ID: Q63HQ0, Q96GG6, Q9H0V0, Q9P1L4
Gene ID:
Mouse(211556) adaptor-related protein complex 1 associated regulatory protein
Rat(362037) adaptor-related protein complex 1 associated regulatory protein
chicken(422693) adaptor-related protein complex 1 associated regulatory protein
domestic cat(101085120) adaptor-related protein complex 1 associated regulatory protein
cow(533664) adaptor-related protein complex 1 associated regulatory protein
dog(610672) AP-1 complex-associated regulatory protein-like
naked mole-rat(101723453) adaptor-related protein complex 1 associated regulatory protein
domestic guinea pig(100718667) adaptor-related protein complex 1 associated regulatory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128426 Rosetta Predictions human pricing
NM_018569 Rosetta Predictions human pricing
XM_001076285 Rosetta Predictions rat pricing
XM_342338 Rosetta Predictions rat pricing
NM_145964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331146 predicted 1146
2 SASI_Hs02_00331147 predicted 555
3 SASI_Hs02_00331148 predicted 941
4 SASI_Hs02_00331149 predicted 1119
5 SASI_Hs02_00331150 predicted 1137
6 SASI_Hs02_00331151 predicted 1095
7 SASI_Hs02_00331152 predicted 1213
8 SASI_Hs02_00331153 predicted 1260
9 SASI_Hs02_00331154 predicted 1204
10 SASI_Hs02_00331155 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078472 predicted 1161
2 SASI_Hs01_00078473 predicted 472
3 SASI_Hs01_00078474 predicted 959
4 SASI_Hs01_00078475 predicted 1134
5 SASI_Hs01_00078476 predicted 1154
6 SASI_Hs01_00078477 predicted 1108
7 SASI_Hs01_00078478 predicted 1223
8 SASI_Hs02_00352118 predicted 873
9 SASI_Hs01_00078479 predicted 1216
10 SASI_Hs01_00078480 predicted 969
11 SASI_Hs01_00078481 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352693 predicted 728
2 SASI_Rn02_00352694 predicted 1253
3 SASI_Rn02_00352695 predicted 791
4 SASI_Rn02_00352696 predicted 909
5 SASI_Rn02_00352697 predicted 1222
6 SASI_Rn02_00352698 predicted 944
7 SASI_Rn02_00352699 predicted 638
8 SASI_Rn02_00352700 predicted 626
9 SASI_Rn02_00352701 predicted 1255
10 SASI_Rn02_00352702 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394147 predicted 724
2 SASI_Rn02_00394148 predicted 1257
3 SASI_Rn02_00394149 predicted 789
4 SASI_Rn02_00394150 predicted 910
5 SASI_Rn02_00394151 predicted 1215
6 SASI_Rn02_00394152 predicted 941
7 SASI_Rn02_00394153 predicted 641
8 SASI_Rn02_00394154 predicted 620
9 SASI_Rn02_00394155 predicted 1255
10 SASI_Rn02_00394156 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341445 predicted 561
2 SASI_Mm02_00341446 predicted 452
3 SASI_Mm02_00341447 predicted 480
4 SASI_Mm02_00341448 predicted 1162
5 SASI_Mm02_00341449 predicted 680
6 SASI_Mm01_00047971 predicted 1169
7 SASI_Mm02_00341450 predicted 462
8 SASI_Mm02_00341451 predicted 539
9 SASI_Mm02_00341452 predicted 866
10 SASI_Mm02_00341453 predicted 501
11 SASI_Mm01_00047967 predicted 518
12 SASI_Mm01_00047968 predicted 381
13 SASI_Mm01_00047969 predicted 615
14 SASI_Mm01_00047970 predicted 352
15 SASI_Mm01_00047972 predicted 512
16 SASI_Mm01_00047973 predicted 604
17 SASI_Mm01_00047974 predicted 507
18 SASI_Mm01_00047975 predicted 381
19 SASI_Mm01_00047976 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018569
VALIDATED
AP1AR MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1 associated regulatory protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018569.2-1070s1c1
Sequence:CCGGGCCGAAATGGATGATAATGGACTCGAGTCCATTATCATCCATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018569.2-2114s1c1
Sequence:CCGGGCCTTCCTTTACCTTGTAGTACTCGAGTACTACAAGGTAAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1095s1c1
Sequence:CCGGCCGAGTATTCTGGATTTGTAACTCGAGTTACAAATCCAGAATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1118s1c1
Sequence:CCGGCCTGTATTAGAACTGTCTGATCTCGAGATCAGACAGTTCTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1721s1c1
Sequence:CCGGGCTGAAGTATCGGCATTACATCTCGAGATGTAATGCCGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018569
VALIDATED
AP1AR MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1 associated regulatory protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018569.2-1070s1c1
Sequence:CCGGGCCGAAATGGATGATAATGGACTCGAGTCCATTATCATCCATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018569.2-2114s1c1
Sequence:CCGGGCCTTCCTTTACCTTGTAGTACTCGAGTACTACAAGGTAAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1095s1c1
Sequence:CCGGCCGAGTATTCTGGATTTGTAACTCGAGTTACAAATCCAGAATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1118s1c1
Sequence:CCGGCCTGTATTAGAACTGTCTGATCTCGAGATCAGACAGTTCTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1721s1c1
Sequence:CCGGGCTGAAGTATCGGCATTACATCTCGAGATGTAATGCCGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018569
VALIDATED
AP1AR MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1 associated regulatory protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018569.2-1070s1c1
Sequence:CCGGGCCGAAATGGATGATAATGGACTCGAGTCCATTATCATCCATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018569.2-2114s1c1
Sequence:CCGGGCCTTCCTTTACCTTGTAGTACTCGAGTACTACAAGGTAAAGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1095s1c1
Sequence:CCGGCCGAGTATTCTGGATTTGTAACTCGAGTTACAAATCCAGAATACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1118s1c1
Sequence:CCGGCCTGTATTAGAACTGTCTGATCTCGAGATCAGACAGTTCTAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018569.2-1721s1c1
Sequence:CCGGGCTGAAGTATCGGCATTACATCTCGAGATGTAATGCCGATACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145964
VALIDATED
AP1AR MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1 associated regulatory protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1810s21c1
Sequence:CCGGCCTTTCACATGCCATTATATTCTCGAGAATATAATGGCATGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1709s21c1
Sequence:CCGGGCAAGAGATGACAGGATTAAACTCGAGTTTAATCCTGTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2079s21c1
Sequence:CCGGCGACCTGTGTCTGAGTCTTAGCTCGAGCTAAGACTCAGACACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2057s21c1
Sequence:CCGGACAAATTATGTTAGCGTATTGCTCGAGCAATACGCTAACATAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1746s21c1
Sequence:CCGGGGATACTTTGAGTTGGTAATACTCGAGTATTACCAACTCAAAGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145964
VALIDATED
AP1AR MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1 associated regulatory protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1810s21c1
Sequence:CCGGCCTTTCACATGCCATTATATTCTCGAGAATATAATGGCATGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1709s21c1
Sequence:CCGGGCAAGAGATGACAGGATTAAACTCGAGTTTAATCCTGTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2079s21c1
Sequence:CCGGCGACCTGTGTCTGAGTCTTAGCTCGAGCTAAGACTCAGACACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2057s21c1
Sequence:CCGGACAAATTATGTTAGCGTATTGCTCGAGCAATACGCTAACATAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1746s21c1
Sequence:CCGGGGATACTTTGAGTTGGTAATACTCGAGTATTACCAACTCAAAGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145964
VALIDATED
AP1AR MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1 associated regulatory protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1810s21c1
Sequence:CCGGCCTTTCACATGCCATTATATTCTCGAGAATATAATGGCATGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1709s21c1
Sequence:CCGGGCAAGAGATGACAGGATTAAACTCGAGTTTAATCCTGTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2079s21c1
Sequence:CCGGCGACCTGTGTCTGAGTCTTAGCTCGAGCTAAGACTCAGACACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-2057s21c1
Sequence:CCGGACAAATTATGTTAGCGTATTGCTCGAGCAATACGCTAACATAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145964.2-1746s21c1
Sequence:CCGGGGATACTTTGAGTTGGTAATACTCGAGTATTACCAACTCAAAGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks