EMAIL THIS PAGE TO A FRIEND

AP1B1

adaptor-related protein complex 1, beta 1 subunit

57 Gene Product Result for
Synonyms: ADTB1 AP105A BAM22 CLAPB2
UniProtKB ID: Q10567, C9JRD1, F8WDL0, P78436, Q20WL3, Q86X54
Gene ID:
Human(162) Summary: Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(11764) adaptor protein complex AP-1, beta 1 subunit
Rat(29663) adaptor-related protein complex 1, beta 1 subunit
domestic guinea pig(100716679) adaptor-related protein complex 1, beta 1 subunit
naked mole-rat(101702149) adaptor-related protein complex 1, beta 1 subunit
sheep(101121713) adaptor-related protein complex 1, beta 1 subunit
Zebrafish(562166) adaptor-related protein complex 1, beta 1 subunit
chicken(417021) adaptor-related protein complex 1, beta 1 subunit
cow(506192) adaptor-related protein complex 1, beta 1 subunit
Horse(100059054) adaptor-related protein complex 1, beta 1 subunit
domestic cat(101086851) adaptor-related protein complex 1, beta 1 subunit
dog(486344) adaptor-related protein complex 1, beta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127 Rosetta Predictions human pricing
NM_145730 Rosetta Predictions human pricing
NM_017277 Rosetta Predictions rat pricing
NM_007454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222162 predicted 1146
2 SASI_Hs01_00222163 predicted 2946
3 SASI_Hs01_00222164 predicted 380
4 SASI_Hs01_00222165 predicted 767
5 SASI_Hs01_00222166 predicted 983
6 SASI_Hs01_00222167 predicted 295
7 SASI_Hs01_00222168 predicted 1848
8 SASI_Hs01_00222169 predicted 429
9 SASI_Hs01_00222170 predicted 388
10 SASI_Hs01_00222171 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152289 predicted 1148
2 SASI_Hs01_00152290 predicted 2928
3 SASI_Hs01_00152291 predicted 378
4 SASI_Hs01_00152292 predicted 775
5 SASI_Hs01_00152293 predicted 981
6 SASI_Hs01_00152294 predicted 298
7 SASI_Hs01_00152295 predicted 1852
8 SASI_Hs01_00152296 predicted 427
9 SASI_Hs01_00152297 predicted 382
10 SASI_Hs01_00152298 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064299 predicted 2189
2 SASI_Rn01_00064300 predicted 375
3 SASI_Rn01_00064301 predicted 2317
4 SASI_Rn01_00064302 predicted 2674
5 SASI_Rn01_00064303 predicted 1913
6 SASI_Rn01_00064304 predicted 927
7 SASI_Rn01_00064305 predicted 1330
8 SASI_Rn02_00261685 predicted 2328
9 SASI_Rn01_00064307 predicted 298
10 SASI_Rn01_00064308 predicted 1110
11 SASI_Rn01_00064306 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188579 predicted 1524
2 SASI_Mm01_00188580 predicted 1076
3 SASI_Mm01_00188581 predicted 1468
4 SASI_Mm01_00188582 predicted 1230
5 SASI_Mm02_00311642 predicted 2635
6 SASI_Mm01_00188583 predicted 2052
7 SASI_Mm01_00188585 predicted 289
8 SASI_Mm01_00188586 predicted 1827
9 SASI_Mm01_00188587 predicted 657
10 SASI_Mm01_00188588 predicted 2787
11 SASI_Mm01_00188584 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127
AP1B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, beta 1 subunit
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-2312s21c1
Sequence:GTACCGGGGCACCCTGTCAGGATCATATCTCGAGATATGATCCTGACAGGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1380s21c1
Sequence:GTACCGGTCCAGACCAAGGTCAACTATGCTCGAGCATAGTTGACCTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127.2-3392s21c1
Sequence:GTACCGGGGTCTCTCCGGTTGGTGTTAACTCGAGTTAACACCAACCGGAGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-662s21c1
Sequence:GTACCGGGGCTTCCTGGACACCCTTAAACTCGAGTTTAAGGGTGTCCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-852s21c1
Sequence:GTACCGGTGGACTGCCTCGCCAACTATACTCGAGTATAGTTGGCGAGGCAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-420s21c1
Sequence:GTACCGGGTCAGCCTGACATGGCCATTACTCGAGTAATGGCCATGTCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-572s21c1
Sequence:GTACCGGCTGAAGGACGAGGATCCATATCTCGAGATATGGATCCTCGTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1855s21c1
Sequence:GTACCGGCACACTGTTAGACGAGCTTATCTCGAGATAAGCTCGTCTAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-526s1c1
Sequence:CCGGCGTTGACAAGATCACAGAGTACTCGAGTACTCTGTGATCTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1159s1c1
Sequence:CCGGCGTGAAGTACAACGACCCTATCTCGAGATAGGGTCGTTGTACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1644s1c1
Sequence:CCGGCCATTGTGAAACTCTTTCTAACTCGAGTTAGAAAGAGTTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-2627s1c1
Sequence:CCGGGCCGTGAAGAACAACATCGATCTCGAGATCGATGTTGTTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1854s1c1
Sequence:CCGGCCACACTGTTAGACGAGCTTACTCGAGTAAGCTCGTCTAACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127
AP1B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, beta 1 subunit
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-2312s21c1
Sequence:GTACCGGGGCACCCTGTCAGGATCATATCTCGAGATATGATCCTGACAGGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1380s21c1
Sequence:GTACCGGTCCAGACCAAGGTCAACTATGCTCGAGCATAGTTGACCTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127.2-3392s21c1
Sequence:GTACCGGGGTCTCTCCGGTTGGTGTTAACTCGAGTTAACACCAACCGGAGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-662s21c1
Sequence:GTACCGGGGCTTCCTGGACACCCTTAAACTCGAGTTTAAGGGTGTCCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-852s21c1
Sequence:GTACCGGTGGACTGCCTCGCCAACTATACTCGAGTATAGTTGGCGAGGCAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-420s21c1
Sequence:GTACCGGGTCAGCCTGACATGGCCATTACTCGAGTAATGGCCATGTCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-572s21c1
Sequence:GTACCGGCTGAAGGACGAGGATCCATATCTCGAGATATGGATCCTCGTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1855s21c1
Sequence:GTACCGGCACACTGTTAGACGAGCTTATCTCGAGATAAGCTCGTCTAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-526s1c1
Sequence:CCGGCGTTGACAAGATCACAGAGTACTCGAGTACTCTGTGATCTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1159s1c1
Sequence:CCGGCGTGAAGTACAACGACCCTATCTCGAGATAGGGTCGTTGTACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1644s1c1
Sequence:CCGGCCATTGTGAAACTCTTTCTAACTCGAGTTAGAAAGAGTTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-2627s1c1
Sequence:CCGGGCCGTGAAGAACAACATCGATCTCGAGATCGATGTTGTTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1854s1c1
Sequence:CCGGCCACACTGTTAGACGAGCTTACTCGAGTAAGCTCGTCTAACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127
AP1B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, beta 1 subunit
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-2312s21c1
Sequence:GTACCGGGGCACCCTGTCAGGATCATATCTCGAGATATGATCCTGACAGGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1380s21c1
Sequence:GTACCGGTCCAGACCAAGGTCAACTATGCTCGAGCATAGTTGACCTTGGTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001127.2-3392s21c1
Sequence:GTACCGGGGTCTCTCCGGTTGGTGTTAACTCGAGTTAACACCAACCGGAGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-662s21c1
Sequence:GTACCGGGGCTTCCTGGACACCCTTAAACTCGAGTTTAAGGGTGTCCAGGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-852s21c1
Sequence:GTACCGGTGGACTGCCTCGCCAACTATACTCGAGTATAGTTGGCGAGGCAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-420s21c1
Sequence:GTACCGGGTCAGCCTGACATGGCCATTACTCGAGTAATGGCCATGTCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-572s21c1
Sequence:GTACCGGCTGAAGGACGAGGATCCATATCTCGAGATATGGATCCTCGTCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127.2-1855s21c1
Sequence:GTACCGGCACACTGTTAGACGAGCTTATCTCGAGATAAGCTCGTCTAACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-526s1c1
Sequence:CCGGCGTTGACAAGATCACAGAGTACTCGAGTACTCTGTGATCTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1159s1c1
Sequence:CCGGCGTGAAGTACAACGACCCTATCTCGAGATAGGGTCGTTGTACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1644s1c1
Sequence:CCGGCCATTGTGAAACTCTTTCTAACTCGAGTTAGAAAGAGTTTCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-2627s1c1
Sequence:CCGGGCCGTGAAGAACAACATCGATCTCGAGATCGATGTTGTTCTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001127.2-1854s1c1
Sequence:CCGGCCACACTGTTAGACGAGCTTACTCGAGTAAGCTCGTCTAACAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007454
VALIDATED
AP1B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, beta 1 subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2839s21c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1080s21c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2456s21c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1113s21c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3390s21c1
Sequence:GTACCGGGTCCTCTGGGTGCCAATATTACTCGAGTAATATTGGCACCCAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3159s21c1
Sequence:GTACCGGTGTCTCCTCCCAGAGTGAAATCTCGAGATTTCACTCTGGGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-3732s1c1
Sequence:CCGGGCACATTTCTTCCCTCTACAACTCGAGTTGTAGAGGGAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2775s1c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2392s1c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1016s1c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1049s1c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007454
VALIDATED
AP1B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, beta 1 subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2839s21c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1080s21c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2456s21c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1113s21c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3390s21c1
Sequence:GTACCGGGTCCTCTGGGTGCCAATATTACTCGAGTAATATTGGCACCCAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3159s21c1
Sequence:GTACCGGTGTCTCCTCCCAGAGTGAAATCTCGAGATTTCACTCTGGGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-3732s1c1
Sequence:CCGGGCACATTTCTTCCCTCTACAACTCGAGTTGTAGAGGGAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2775s1c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2392s1c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1016s1c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1049s1c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007454
VALIDATED
AP1B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, beta 1 subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2839s21c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1080s21c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-2456s21c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007454.2-1113s21c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3390s21c1
Sequence:GTACCGGGTCCTCTGGGTGCCAATATTACTCGAGTAATATTGGCACCCAGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007454.2-3159s21c1
Sequence:GTACCGGTGTCTCCTCCCAGAGTGAAATCTCGAGATTTCACTCTGGGAGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100550    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-3732s1c1
Sequence:CCGGGCACATTTCTTCCCTCTACAACTCGAGTTGTAGAGGGAAGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2775s1c1
Sequence:CCGGGCCAGGATATGCTCTACCAATCTCGAGATTGGTAGAGCATATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-2392s1c1
Sequence:CCGGCCAGTTCAATCGTAACAGCTTCTCGAGAAGCTGTTACGATTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1016s1c1
Sequence:CCGGCTGCGCAACATCAATCTCATTCTCGAGAATGAGATTGATGTTGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007454.1-1049s1c1
Sequence:CCGGCCAGAGATCTTGAAGCATGAACTCGAGTTCATGCTTCAAGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks