EMAIL THIS PAGE TO A FRIEND

AP1G1

adaptor-related protein complex 1, gamma 1 subunit

Synonyms: ADTG CLAPG1
UniProtKB ID: O43747, O75709, O75842, Q9UG09, Q9Y3U4
Gene ID:
Human(164) Summary: Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11765) adaptor protein complex AP-1, gamma 1 subunit
Rat(171494) adaptor-related protein complex 1, gamma 1 subunit
Zebrafish(324466) adaptor-related protein complex 1, gamma 1 subunit
chicken(415880) adaptor-related protein complex 1, gamma 1 subunit
dog(479666) adaptor-related protein complex 1, gamma 1 subunit
Horse(100054483) adaptor-related protein complex 1, gamma 1 subunit
cow(507677) adaptor-related protein complex 1, gamma 1 subunit
domestic cat(101101527) adaptor-related protein complex 1, gamma 1 subunit
sheep(101104002) adaptor-related protein complex 1, gamma 1 subunit
Domestic Rabbit(100355117) adaptor-related protein complex 1, gamma 1 subunit
naked mole-rat(101700868) adaptor-related protein complex 1, gamma 1 subunit
domestic guinea pig(100720354) adaptor-related protein complex 1, gamma 1 subunit
295 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030007 Rosetta Predictions human pricing
NM_001128 Rosetta Predictions human pricing
NM_134460 Rosetta Predictions rat pricing
NM_009677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151148 predicted 1609
2 SASI_Hs01_00151149 predicted 2085
3 SASI_Hs01_00151150 predicted 624
4 SASI_Hs01_00151151 predicted 1365
5 SASI_Hs01_00151152 predicted 1672
6 SASI_Hs01_00151154 predicted 2778
7 SASI_Hs02_00307627 predicted 2292
8 SASI_Hs01_00151155 predicted 2546
9 SASI_Hs02_00307628 predicted 547
10 SASI_Hs01_00151156 predicted 1647
11 SASI_Hs01_00151153 predicted 1989
12 SASI_Hs01_00151157 predicted 2709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165796 predicted 1593
2 SASI_Hs01_00165797 predicted 2078
3 SASI_Hs01_00165798 predicted 623
4 SASI_Hs01_00165799 predicted 1348
5 SASI_Hs01_00165800 predicted 1665
6 SASI_Hs01_00165802 predicted 2775
7 SASI_Hs02_00330484 predicted 2279
8 SASI_Hs01_00165803 predicted 2533
9 SASI_Hs02_00330485 predicted 549
10 SASI_Hs01_00165804 predicted 1638
11 SASI_Hs01_00165801 predicted 1979
12 SASI_Hs01_00165805 predicted 2698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268058 predicted 807
2 SASI_Rn02_00268059 predicted 850
3 SASI_Rn02_00268060 predicted 332
4 SASI_Rn02_00268061 predicted 863
5 SASI_Rn02_00268062 predicted 1596
6 SASI_Rn02_00268063 predicted 1619
7 SASI_Rn02_00268064 predicted 1154
8 SASI_Rn02_00268065 predicted 256
9 SASI_Rn02_00268066 predicted 1608
10 SASI_Rn02_00268067 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072710 predicted 634
2 SASI_Mm01_00072711 predicted 1644
3 SASI_Mm01_00072712 predicted 1931
4 SASI_Mm02_00316736 predicted 1108
5 SASI_Mm01_00072713 predicted 639
6 SASI_Mm01_00072714 predicted 1123
7 SASI_Mm01_00072716 predicted 586
8 SASI_Mm01_00072717 predicted 2542
9 SASI_Mm01_00072718 predicted 2106
10 SASI_Mm01_00072719 predicted 1692
11 SASI_Mm01_00072715 predicted 1859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128
VALIDATED
AP1G1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, gamma 1 subunit
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1434s1c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-795s1c1
Sequence:CCGGGCTGTTCATGTCATCAGGAAACTCGAGTTTCCTGATGACATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-2437s1c1
Sequence:CCGGCCTCCATCACAGCATACAGTACTCGAGTACTGTATGCTGTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1608s1c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-819s1c1
Sequence:CCGGCCTGAACTTATGGAGATGTTTCTCGAGAAACATCTCCATAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-988s21c1
Sequence:GTACCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-555s21c1
Sequence:GTACCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1819s21c1
Sequence:GTACCGGAGGATGAAGTGTTGGATATTTCTCGAGAAATATCCAACACTTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1599s21c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1425s21c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-3054s21c1
Sequence:CCGGTTACAGCCAGAATCAACATTCCTCGAGGAATGTTGATTCTGGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1928s21c1
Sequence:CCGGTTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1227s21c1
Sequence:CCGGTTGCGAGTCCTAGCCATAAATCTCGAGATTTATGGCTAGGACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2539s21c1
Sequence:GTACCGGAGCTAGATATGACGGACTTTGCTCGAGCAAAGTCCGTCATATCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1483s21c1
Sequence:GTACCGGATTCGTGTGAGCCAGAATTTACTCGAGTAAATTCTGGCTCACACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2177s21c1
Sequence:GTACCGGCACCAGCCAGGCCAATGATTTCTCGAGAAATCATTGGCCTGGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128
VALIDATED
AP1G1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, gamma 1 subunit
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1434s1c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-795s1c1
Sequence:CCGGGCTGTTCATGTCATCAGGAAACTCGAGTTTCCTGATGACATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-2437s1c1
Sequence:CCGGCCTCCATCACAGCATACAGTACTCGAGTACTGTATGCTGTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1608s1c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-819s1c1
Sequence:CCGGCCTGAACTTATGGAGATGTTTCTCGAGAAACATCTCCATAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-988s21c1
Sequence:GTACCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-555s21c1
Sequence:GTACCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1819s21c1
Sequence:GTACCGGAGGATGAAGTGTTGGATATTTCTCGAGAAATATCCAACACTTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1599s21c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1425s21c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-3054s21c1
Sequence:CCGGTTACAGCCAGAATCAACATTCCTCGAGGAATGTTGATTCTGGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1928s21c1
Sequence:CCGGTTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1227s21c1
Sequence:CCGGTTGCGAGTCCTAGCCATAAATCTCGAGATTTATGGCTAGGACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2539s21c1
Sequence:GTACCGGAGCTAGATATGACGGACTTTGCTCGAGCAAAGTCCGTCATATCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1483s21c1
Sequence:GTACCGGATTCGTGTGAGCCAGAATTTACTCGAGTAAATTCTGGCTCACACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2177s21c1
Sequence:GTACCGGCACCAGCCAGGCCAATGATTTCTCGAGAAATCATTGGCCTGGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128
VALIDATED
AP1G1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, gamma 1 subunit
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1434s1c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-795s1c1
Sequence:CCGGGCTGTTCATGTCATCAGGAAACTCGAGTTTCCTGATGACATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001128.4-2437s1c1
Sequence:CCGGCCTCCATCACAGCATACAGTACTCGAGTACTGTATGCTGTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-1608s1c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001128.4-819s1c1
Sequence:CCGGCCTGAACTTATGGAGATGTTTCTCGAGAAACATCTCCATAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-988s21c1
Sequence:GTACCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-555s21c1
Sequence:GTACCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1819s21c1
Sequence:GTACCGGAGGATGAAGTGTTGGATATTTCTCGAGAAATATCCAACACTTCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1599s21c1
Sequence:CCGGGCAGGAAGTTATGTTCGTGATCTCGAGATCACGAACATAACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1425s21c1
Sequence:CCGGGCCCTGGTAAATGGGAATAATCTCGAGATTATTCCCATTTACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293897    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-3054s21c1
Sequence:CCGGTTACAGCCAGAATCAACATTCCTCGAGGAATGTTGATTCTGGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1928s21c1
Sequence:CCGGTTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001128.5-1227s21c1
Sequence:CCGGTTGCGAGTCCTAGCCATAAATCTCGAGATTTATGGCTAGGACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2539s21c1
Sequence:GTACCGGAGCTAGATATGACGGACTTTGCTCGAGCAAAGTCCGTCATATCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-1483s21c1
Sequence:GTACCGGATTCGTGTGAGCCAGAATTTACTCGAGTAAATTCTGGCTCACACGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128.5-2177s21c1
Sequence:GTACCGGCACCAGCCAGGCCAATGATTTCTCGAGAAATCATTGGCCTGGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009677
VALIDATED
AP1G1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, gamma 1 subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-3476s1c1
Sequence:CCGGGCTCCCTTTCTCTTCGTTCTTCTCGAGAAGAACGAAGAGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009677.3-2648s1c1
Sequence:CCGGCGGATCAAGCTCACATATAATCTCGAGATTATATGTGAGCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-880s1c1
Sequence:CCGGGCTCGCACATTTCAGAAAGAACTCGAGTTCTTTCTGAAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-1694s1c1
Sequence:CCGGGCGTGGTGTATAGGTGAATATCTCGAGATATTCACCTATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-915s1c1
Sequence:CCGGCCCAATTAGTTCGTATTCTAACTCGAGTTAGAATACGAACTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1717s21c1
Sequence:CCGGAGGCGATTCTCGGTGACTATTCTCGAGAATAGTCACCGAGAATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1949s21c1
Sequence:CCGGCTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1248s21c1
Sequence:CCGGTTGCGAGTTCTAGCCATAAATCTCGAGATTTATGGCTAGAACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1009s21c1
Sequence:CCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-567s21c1
Sequence:CCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-2950s21c1
Sequence:CCGGTGACCTTGAAGCATCAGTAAACTCGAGTTTACTGATGCTTCAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009677
VALIDATED
AP1G1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, gamma 1 subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-3476s1c1
Sequence:CCGGGCTCCCTTTCTCTTCGTTCTTCTCGAGAAGAACGAAGAGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009677.3-2648s1c1
Sequence:CCGGCGGATCAAGCTCACATATAATCTCGAGATTATATGTGAGCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-880s1c1
Sequence:CCGGGCTCGCACATTTCAGAAAGAACTCGAGTTCTTTCTGAAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-1694s1c1
Sequence:CCGGGCGTGGTGTATAGGTGAATATCTCGAGATATTCACCTATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-915s1c1
Sequence:CCGGCCCAATTAGTTCGTATTCTAACTCGAGTTAGAATACGAACTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1717s21c1
Sequence:CCGGAGGCGATTCTCGGTGACTATTCTCGAGAATAGTCACCGAGAATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1949s21c1
Sequence:CCGGCTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1248s21c1
Sequence:CCGGTTGCGAGTTCTAGCCATAAATCTCGAGATTTATGGCTAGAACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1009s21c1
Sequence:CCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-567s21c1
Sequence:CCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-2950s21c1
Sequence:CCGGTGACCTTGAAGCATCAGTAAACTCGAGTTTACTGATGCTTCAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009677
VALIDATED
AP1G1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, gamma 1 subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-3476s1c1
Sequence:CCGGGCTCCCTTTCTCTTCGTTCTTCTCGAGAAGAACGAAGAGAAAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009677.3-2648s1c1
Sequence:CCGGCGGATCAAGCTCACATATAATCTCGAGATTATATGTGAGCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-880s1c1
Sequence:CCGGGCTCGCACATTTCAGAAAGAACTCGAGTTCTTTCTGAAATGTGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-1694s1c1
Sequence:CCGGGCGTGGTGTATAGGTGAATATCTCGAGATATTCACCTATACACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009677.3-915s1c1
Sequence:CCGGCCCAATTAGTTCGTATTCTAACTCGAGTTAGAATACGAACTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1717s21c1
Sequence:CCGGAGGCGATTCTCGGTGACTATTCTCGAGAATAGTCACCGAGAATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1949s21c1
Sequence:CCGGCTGTACTGTAAACCGAATTAACTCGAGTTAATTCGGTTTACAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1248s21c1
Sequence:CCGGTTGCGAGTTCTAGCCATAAATCTCGAGATTTATGGCTAGAACTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-1009s21c1
Sequence:CCGGACCTCATCATGTCCGGATATTCTCGAGAATATCCGGACATGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-567s21c1
Sequence:CCGGGACAAACGCATTGGCTATTTACTCGAGTAAATAGCCAATGCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009677.4-2950s21c1
Sequence:CCGGTGACCTTGAAGCATCAGTAAACTCGAGTTTACTGATGCTTCAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks