EMAIL THIS PAGE TO A FRIEND

AP1G2

adaptor-related protein complex 1, gamma 2 subunit

68 Gene Product Result for
Synonyms: G2AD
UniProtKB ID: O75843, D3DS51, O75504
Gene ID:
Human(8906) Summary: Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is compsed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. This protein along with the complex is thought to function at some trafficking step in the complex pathways between the trans-Golgi network and the cell surface. There are two alternatively spliced transcript variants of this gene encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(11766) adaptor protein complex AP-1, gamma 2 subunit
Rat(290215) adaptor protein complex AP-1, gamma 2 subunit
domestic guinea pig(100724955) adaptor-related protein complex 1, gamma 2 subunit
naked mole-rat(101708508) adaptor-related protein complex 1, gamma 2 subunit
sheep(101119310) adaptor-related protein complex 1, gamma 2 subunit
Domestic Rabbit(100341454) adaptor-related protein complex 1, gamma 2 subunit
Zebrafish(100007877) adaptor-related protein complex 1, gamma 2 subunit
cow(100126076) adaptor-related protein complex 1, gamma 2 subunit
Horse(100052094) adaptor-related protein complex 1, gamma 2 subunit
domestic cat(101097650) adaptor-related protein complex 1, gamma 2 subunit
dog(480253) adaptor-related protein complex 1, gamma 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003917 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087361 MISSION® esiRNA esiRNA targeting mouse Ap1g2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003917 Rosetta Predictions human pricing
NM_080545 Rosetta Predictions human pricing
XM_214197 Rosetta Predictions rat pricing
NM_001110795 Rosetta Predictions mouse pricing
NM_007455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043109 predicted 2358
2 SASI_Hs01_00043110 predicted 1566
3 SASI_Hs01_00043111 predicted 2453
4 SASI_Hs02_00336557 predicted 569
5 SASI_Hs01_00043115 predicted 2347
6 SASI_Hs02_00336558 predicted 553
7 SASI_Hs01_00043116 predicted 2038
8 SASI_Hs02_00336559 predicted 787
9 SASI_Hs02_00336560 predicted 602
10 SASI_Hs01_00043117 predicted 1692
11 SASI_Hs01_00043112 predicted 1546
12 SASI_Hs01_00043113 predicted 2422
13 SASI_Hs01_00043114 predicted 1529
14 SASI_Hs01_00043118 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243612 predicted 2787
2 SASI_Hs01_00243613 predicted 1989
3 SASI_Hs01_00243614 predicted 2869
4 SASI_Hs02_00362291 predicted 994
5 SASI_Hs01_00243618 predicted 2767
6 SASI_Hs02_00362292 predicted 971
7 SASI_Hs01_00243619 predicted 2460
8 SASI_Hs02_00362293 predicted 1203
9 SASI_Hs02_00362294 predicted 1020
10 SASI_Hs01_00243620 predicted 2120
11 SASI_Hs01_00243615 predicted 1972
12 SASI_Hs01_00243616 predicted 2845
13 SASI_Hs01_00243617 predicted 1960
14 SASI_Hs01_00243621 predicted 2107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194546 predicted 382
2 SASI_Rn01_00194547 predicted 844
3 SASI_Rn01_00194548 predicted 295
4 SASI_Rn01_00194549 predicted 2291
5 SASI_Rn01_00194550 predicted 2004
6 SASI_Rn01_00194551 predicted 447
7 SASI_Rn01_00194552 predicted 293
8 SASI_Rn01_00194553 predicted 669
9 SASI_Rn01_00194554 predicted 2295
10 SASI_Rn01_00194555 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305758 predicted 1019
2 SASI_Mm02_00305759 predicted 1278
3 SASI_Mm02_00305760 predicted 316
4 SASI_Mm02_00305761 predicted 1270
5 SASI_Mm02_00305762 predicted 2115
6 SASI_Mm02_00305763 predicted 2257
7 SASI_Mm02_00305764 predicted 2258
8 SASI_Mm02_00305765 predicted 1291
9 SASI_Mm02_00305766 predicted 2050
10 SASI_Mm02_00305767 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033257 predicted 1080
2 SASI_Mm01_00033258 predicted 1328
3 SASI_Mm01_00033259 predicted 377
4 SASI_Mm01_00033260 predicted 1329
5 SASI_Mm01_00033261 predicted 2162
6 SASI_Mm01_00033262 predicted 2303
7 SASI_Mm01_00033263 predicted 2312
8 SASI_Mm01_00033264 predicted 1339
9 SASI_Mm01_00033265 predicted 2099
10 SASI_Mm01_00033266 predicted 2269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007455
VALIDATED
AP1G2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, gamma 2 subunit
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1509s21c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.4-2132s21c1
Sequence:CCGGAGGGCCTACAGCTGGATCTTTCTCGAGAAAGATCCAGCTGTAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007455.4-2505s21c1
Sequence:CCGGTGGTGTTCAAGGAACGGAAATCTCGAGATTTCCGTTCCTTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2408s21c1
Sequence:CCGGCCAGGCACCTTTGCGACTTAACTCGAGTTAAGTCGCAAAGGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007455.4-173s21c1
Sequence:CCGGAGAAGGAGTGCGCCCAAATTCCTCGAGGAATTTGGGCGCACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2582s21c1
Sequence:CCGGCCACGTAAATGGCGAAGTAAACTCGAGTTTACTTCGCCATTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1820s21c1
Sequence:CCGGACAGCGGGCTGTGGAGTATAACTCGAGTTATACTCCACAGCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-669s21c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-2449s1c1
Sequence:CCGGCGGAAATAACAGACCCACGTACTCGAGTACGTGGGTCTGTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1878s1c1
Sequence:CCGGGCCACCAAACTCTTAGATCTACTCGAGTAGATCTAAGAGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-549s1c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1389s1c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-800s1c1
Sequence:CCGGTGAAGAAAGTAGCGAGACCATCTCGAGATGGTCTCGCTACTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007455
VALIDATED
AP1G2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, gamma 2 subunit
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1509s21c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.4-2132s21c1
Sequence:CCGGAGGGCCTACAGCTGGATCTTTCTCGAGAAAGATCCAGCTGTAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007455.4-2505s21c1
Sequence:CCGGTGGTGTTCAAGGAACGGAAATCTCGAGATTTCCGTTCCTTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2408s21c1
Sequence:CCGGCCAGGCACCTTTGCGACTTAACTCGAGTTAAGTCGCAAAGGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007455.4-173s21c1
Sequence:CCGGAGAAGGAGTGCGCCCAAATTCCTCGAGGAATTTGGGCGCACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2582s21c1
Sequence:CCGGCCACGTAAATGGCGAAGTAAACTCGAGTTTACTTCGCCATTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1820s21c1
Sequence:CCGGACAGCGGGCTGTGGAGTATAACTCGAGTTATACTCCACAGCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-669s21c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-2449s1c1
Sequence:CCGGCGGAAATAACAGACCCACGTACTCGAGTACGTGGGTCTGTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1878s1c1
Sequence:CCGGGCCACCAAACTCTTAGATCTACTCGAGTAGATCTAAGAGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-549s1c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1389s1c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-800s1c1
Sequence:CCGGTGAAGAAAGTAGCGAGACCATCTCGAGATGGTCTCGCTACTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007455
VALIDATED
AP1G2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, gamma 2 subunit
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1509s21c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.4-2132s21c1
Sequence:CCGGAGGGCCTACAGCTGGATCTTTCTCGAGAAAGATCCAGCTGTAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007455.4-2505s21c1
Sequence:CCGGTGGTGTTCAAGGAACGGAAATCTCGAGATTTCCGTTCCTTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2408s21c1
Sequence:CCGGCCAGGCACCTTTGCGACTTAACTCGAGTTAAGTCGCAAAGGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007455.4-173s21c1
Sequence:CCGGAGAAGGAGTGCGCCCAAATTCCTCGAGGAATTTGGGCGCACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306278    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-2582s21c1
Sequence:CCGGCCACGTAAATGGCGAAGTAAACTCGAGTTTACTTCGCCATTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-1820s21c1
Sequence:CCGGACAGCGGGCTGTGGAGTATAACTCGAGTTATACTCCACAGCCCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007455.3-669s21c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115376    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-2449s1c1
Sequence:CCGGCGGAAATAACAGACCCACGTACTCGAGTACGTGGGTCTGTTATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1878s1c1
Sequence:CCGGGCCACCAAACTCTTAGATCTACTCGAGTAGATCTAAGAGTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-549s1c1
Sequence:CCGGCCACCTTGTACCAAACTGCTTCTCGAGAAGCAGTTTGGTACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-1389s1c1
Sequence:CCGGCGCCGTCTCTACAGTGCCTTACTCGAGTAAGGCACTGTAGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007455.1-800s1c1
Sequence:CCGGTGAAGAAAGTAGCGAGACCATCTCGAGATGGTCTCGCTACTTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003917
VALIDATED
AP1G2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, gamma 2 subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-2038s21c1
Sequence:CCGGTGACACACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1443s21c1
Sequence:CCGGTAAGCCTGGCTCTGGTAAATACTCGAGTATTTACCAGAGCCAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003917.2-1257s21c1
Sequence:CCGGGGGTTCTAGCTGTCAACATTCCTCGAGGAATGTTGACAGCTAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1178s21c1
Sequence:CCGGACCAGCCGAAATGCCGGAAATCTCGAGATTTCCGGCATTTCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-630s21c1
Sequence:CCGGACGATGCCCACCTGCTCATTACTCGAGTAATGAGCAGGTGGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1451s1c1
Sequence:CCGGGCTCTGGTAAATAGCTCCAATCTCGAGATTGGAGCTATTTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-2615s1c1
Sequence:CCGGCGCCTCACCTACGACCACTTTCTCGAGAAAGTGGTCGTAGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-2120s1c1
Sequence:CCGGGCTGATGAGGAAGCAAAGGAACTCGAGTTCCTTTGCTTCCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1288s1c1
Sequence:CCGGCCTACTCAACAGTGACAGGAACTCGAGTTCCTGTCACTGTTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-640s1c1
Sequence:CCGGCCTGCTCATTACCAACAGCATCTCGAGATGCTGTTGGTAATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003917
VALIDATED
AP1G2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, gamma 2 subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-2038s21c1
Sequence:CCGGTGACACACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1443s21c1
Sequence:CCGGTAAGCCTGGCTCTGGTAAATACTCGAGTATTTACCAGAGCCAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003917.2-1257s21c1
Sequence:CCGGGGGTTCTAGCTGTCAACATTCCTCGAGGAATGTTGACAGCTAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1178s21c1
Sequence:CCGGACCAGCCGAAATGCCGGAAATCTCGAGATTTCCGGCATTTCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-630s21c1
Sequence:CCGGACGATGCCCACCTGCTCATTACTCGAGTAATGAGCAGGTGGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1451s1c1
Sequence:CCGGGCTCTGGTAAATAGCTCCAATCTCGAGATTGGAGCTATTTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-2615s1c1
Sequence:CCGGCGCCTCACCTACGACCACTTTCTCGAGAAAGTGGTCGTAGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-2120s1c1
Sequence:CCGGGCTGATGAGGAAGCAAAGGAACTCGAGTTCCTTTGCTTCCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1288s1c1
Sequence:CCGGCCTACTCAACAGTGACAGGAACTCGAGTTCCTGTCACTGTTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-640s1c1
Sequence:CCGGCCTGCTCATTACCAACAGCATCTCGAGATGCTGTTGGTAATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003917
VALIDATED
AP1G2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, gamma 2 subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-2038s21c1
Sequence:CCGGTGACACACTCTTCCGGAAATACTCGAGTATTTCCGGAAGAGTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1443s21c1
Sequence:CCGGTAAGCCTGGCTCTGGTAAATACTCGAGTATTTACCAGAGCCAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003917.2-1257s21c1
Sequence:CCGGGGGTTCTAGCTGTCAACATTCCTCGAGGAATGTTGACAGCTAGAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-1178s21c1
Sequence:CCGGACCAGCCGAAATGCCGGAAATCTCGAGATTTCCGGCATTTCGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003917.2-630s21c1
Sequence:CCGGACGATGCCCACCTGCTCATTACTCGAGTAATGAGCAGGTGGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1451s1c1
Sequence:CCGGGCTCTGGTAAATAGCTCCAATCTCGAGATTGGAGCTATTTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-2615s1c1
Sequence:CCGGCGCCTCACCTACGACCACTTTCTCGAGAAAGTGGTCGTAGGTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-2120s1c1
Sequence:CCGGGCTGATGAGGAAGCAAAGGAACTCGAGTTCCTTTGCTTCCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003917.2-1288s1c1
Sequence:CCGGCCTACTCAACAGTGACAGGAACTCGAGTTCCTGTCACTGTTGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003917.2-640s1c1
Sequence:CCGGCCTGCTCATTACCAACAGCATCTCGAGATGCTGTTGGTAATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks