EMAIL THIS PAGE TO A FRIEND

AP1M1

adaptor-related protein complex 1, mu 1 subunit

46 Gene Product Result for
Synonyms: AP47 CLAPM2 CLTNM MU-1A
UniProtKB ID: Q9BXS5, Q4TTY5
Gene ID:
Human(8907) Summary: The protein encoded by this gene is the medium chain of the trans-Golgi network clathrin-associated protein complex AP-1. The other components of this complex are beta-prime-adaptin, gamma-adaptin, and the small chain AP1S1. This complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11767) adaptor-related protein complex AP-1, mu subunit 1
Rat(306332) adaptor-related protein complex 1, mu 1 subunit
Zebrafish(100330411) adaptor-related protein complex 1, mu 1 subunit
chicken(420149) adaptor-related protein complex 1, mu 1 subunit
dog(609840) adaptor-related protein complex 1, mu 1 subunit
Horse(100069477) adaptor-related protein complex 1, mu 1 subunit
cow(504310) adaptor-related protein complex 1, mu 1 subunit
domestic cat(101093585) adaptor-related protein complex 1, mu 1 subunit
sheep(101116140) adaptor-related protein complex 1, mu 1 subunit
Domestic Rabbit(100352212) adaptor-related protein complex 1, mu 1 subunit
naked mole-rat(101705051) adaptor-related protein complex 1, mu 1 subunit
domestic guinea pig(100729705) adaptor-related protein complex 1, mu 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032493 Rosetta Predictions human pricing
NM_001044239 Rosetta Predictions rat pricing
NM_007456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113557 predicted 801
2 SASI_Hs01_00113558 predicted 587
3 SASI_Hs01_00113559 predicted 929
4 SASI_Hs01_00113561 predicted 1277
5 SASI_Hs01_00113562 predicted 1116
6 SASI_Hs01_00113563 predicted 975
7 SASI_Hs01_00113564 predicted 998
8 SASI_Hs01_00113565 predicted 743
9 SASI_Hs01_00113566 predicted 1179
10 SASI_Hs02_00359962 predicted 661
11 SASI_Hs01_00113560 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205117 predicted 1056
2 SASI_Rn02_00205118 predicted 570
3 SASI_Rn02_00205119 predicted 705
4 SASI_Rn02_00205120 predicted 636
5 SASI_Rn02_00205121 predicted 960
6 SASI_Rn02_00205122 predicted 932
7 SASI_Rn02_00205123 predicted 549
8 SASI_Rn02_00205124 predicted 710
9 SASI_Rn02_00205125 predicted 378
10 SASI_Rn02_00205126 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080995 predicted 700
2 SASI_Mm01_00080996 predicted 981
3 SASI_Mm02_00311643 predicted 690
4 SASI_Mm01_00080998 predicted 883
5 SASI_Mm01_00080999 predicted 225
6 SASI_Mm01_00081001 predicted 572
7 SASI_Mm01_00081002 predicted 932
8 SASI_Mm01_00081003 predicted 546
9 SASI_Mm01_00081004 predicted 966
10 SASI_Mm02_00311644 predicted 876
11 SASI_Mm01_00080997 predicted 696
12 SASI_Mm01_00081000 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032493
VALIDATED
AP1M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, mu 1 subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-919s1c1
Sequence:CCGGCCCACGTCAAGCCTTTGATATCTCGAGATATCAAAGGCTTGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-270s1c1
Sequence:CCGGGTCCGTTTCATGTGGATCAAACTCGAGTTTGATCCACATGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032493.2-590s1c1
Sequence:CCGGCGAAGGCATCAAGTATCGGAACTCGAGTTCCGATACTTGATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-747s1c1
Sequence:CCGGCTCAACGACAAGGTCCTCTTTCTCGAGAAAGAGGACCTTGTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-1332s1c1
Sequence:CCGGGTGCGTTATATCACGCAGAATCTCGAGATTCTGCGTGATATAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-586s21c1
Sequence:CCGGGGTCCGAAGGCATCAAGTATCCTCGAGGATACTTGATGCCTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-835s21c1
Sequence:CCGGGGCTATCACGCTTCGAGAATGCTCGAGCATTCTCGAAGCGTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-1798s21c1
Sequence:GTACCGGGTTGAACGTTATGGGTTTATGCTCGAGCATAAACCCATAACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-748s21c1
Sequence:CCGGTCAACGACAAGGTCCTCTTTGCTCGAGCAAAGAGGACCTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-271s21c1
Sequence:CCGGTCCGTTTCATGTGGATCAAACCTCGAGGTTTGATCCACATGAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032493
VALIDATED
AP1M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, mu 1 subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-919s1c1
Sequence:CCGGCCCACGTCAAGCCTTTGATATCTCGAGATATCAAAGGCTTGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-270s1c1
Sequence:CCGGGTCCGTTTCATGTGGATCAAACTCGAGTTTGATCCACATGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032493.2-590s1c1
Sequence:CCGGCGAAGGCATCAAGTATCGGAACTCGAGTTCCGATACTTGATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-747s1c1
Sequence:CCGGCTCAACGACAAGGTCCTCTTTCTCGAGAAAGAGGACCTTGTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-1332s1c1
Sequence:CCGGGTGCGTTATATCACGCAGAATCTCGAGATTCTGCGTGATATAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-586s21c1
Sequence:CCGGGGTCCGAAGGCATCAAGTATCCTCGAGGATACTTGATGCCTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-835s21c1
Sequence:CCGGGGCTATCACGCTTCGAGAATGCTCGAGCATTCTCGAAGCGTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-1798s21c1
Sequence:GTACCGGGTTGAACGTTATGGGTTTATGCTCGAGCATAAACCCATAACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-748s21c1
Sequence:CCGGTCAACGACAAGGTCCTCTTTGCTCGAGCAAAGAGGACCTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-271s21c1
Sequence:CCGGTCCGTTTCATGTGGATCAAACCTCGAGGTTTGATCCACATGAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032493
VALIDATED
AP1M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, mu 1 subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-919s1c1
Sequence:CCGGCCCACGTCAAGCCTTTGATATCTCGAGATATCAAAGGCTTGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-270s1c1
Sequence:CCGGGTCCGTTTCATGTGGATCAAACTCGAGTTTGATCCACATGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032493.2-590s1c1
Sequence:CCGGCGAAGGCATCAAGTATCGGAACTCGAGTTCCGATACTTGATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-747s1c1
Sequence:CCGGCTCAACGACAAGGTCCTCTTTCTCGAGAAAGAGGACCTTGTCGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032493.2-1332s1c1
Sequence:CCGGGTGCGTTATATCACGCAGAATCTCGAGATTCTGCGTGATATAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-586s21c1
Sequence:CCGGGGTCCGAAGGCATCAAGTATCCTCGAGGATACTTGATGCCTTCGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-835s21c1
Sequence:CCGGGGCTATCACGCTTCGAGAATGCTCGAGCATTCTCGAAGCGTGATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032493.2-1798s21c1
Sequence:GTACCGGGTTGAACGTTATGGGTTTATGCTCGAGCATAAACCCATAACGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-748s21c1
Sequence:CCGGTCAACGACAAGGTCCTCTTTGCTCGAGCAAAGAGGACCTTGTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032493.2-271s21c1
Sequence:CCGGTCCGTTTCATGTGGATCAAACCTCGAGGTTTGATCCACATGAAACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007456
AP1M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, mu 1 subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-231s1c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007456.1-1641s1c1
Sequence:CCGGGCTGAGCATAGTTGGCTCATTCTCGAGAATGAGCCAACTATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-1026s1c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-549s1c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-234s1c1
Sequence:CCGGCGTTCGTTTCATGTGGATTAACTCGAGTTAATCCACATGAAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007456.4-1756s21c1
Sequence:GTACCGGTGGTCTGTATGCCGGATAGTTCTCGAGAACTATCCGGCATACAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-229s21c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-1024s21c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-993s21c1
Sequence:CCGGACAATGTAGAGATCCATATACCTCGAGGTATATGGATCTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-547s21c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-809s21c1
Sequence:CCGGTTTGAGAACGACCGCACTATCCTCGAGGATAGTGCGGTCGTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007456
AP1M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, mu 1 subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-231s1c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007456.1-1641s1c1
Sequence:CCGGGCTGAGCATAGTTGGCTCATTCTCGAGAATGAGCCAACTATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-1026s1c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-549s1c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-234s1c1
Sequence:CCGGCGTTCGTTTCATGTGGATTAACTCGAGTTAATCCACATGAAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007456.4-1756s21c1
Sequence:GTACCGGTGGTCTGTATGCCGGATAGTTCTCGAGAACTATCCGGCATACAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-229s21c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-1024s21c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-993s21c1
Sequence:CCGGACAATGTAGAGATCCATATACCTCGAGGTATATGGATCTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-547s21c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-809s21c1
Sequence:CCGGTTTGAGAACGACCGCACTATCCTCGAGGATAGTGCGGTCGTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007456
AP1M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, mu 1 subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-231s1c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007456.1-1641s1c1
Sequence:CCGGGCTGAGCATAGTTGGCTCATTCTCGAGAATGAGCCAACTATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-1026s1c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-549s1c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007456.1-234s1c1
Sequence:CCGGCGTTCGTTTCATGTGGATTAACTCGAGTTAATCCACATGAAACGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007456.4-1756s21c1
Sequence:GTACCGGTGGTCTGTATGCCGGATAGTTCTCGAGAACTATCCGGCATACAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-229s21c1
Sequence:CCGGTGGCGTTCGTTTCATGTGGATCTCGAGATCCACATGAAACGAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-1024s21c1
Sequence:CCGGCGATGCTGATTCACCCAAGTTCTCGAGAACTTGGGTGAATCAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-993s21c1
Sequence:CCGGACAATGTAGAGATCCATATACCTCGAGGTATATGGATCTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-547s21c1
Sequence:CCGGGCGTTCAGAAGGCATCAAGTACTCGAGTACTTGATGCCTTCTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007456.4-809s21c1
Sequence:CCGGTTTGAGAACGACCGCACTATCCTCGAGGATAGTGCGGTCGTTCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks