EMAIL THIS PAGE TO A FRIEND

AP1M2

adaptor-related protein complex 1, mu 2 subunit

Synonyms: AP1-mu2 HSMU1B MU-1B MU1B mu2
UniProtKB ID: Q9Y6Q5, B2RDV5, Q9BSI8
Gene ID:
Human(10053) Summary: This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. [provided by RefSeq, Jul 2008]
Mouse(11768) adaptor protein complex AP-1, mu 2 subunit
Rat(367038) adaptor-related protein complex 1, mu 2 subunit
domestic guinea pig(100723128) adaptor-related protein complex 1, mu 2 subunit
naked mole-rat(101721337) adaptor-related protein complex 1, mu 2 subunit
sheep(101114351) adaptor-related protein complex 1, mu 2 subunit
Zebrafish(403021) adaptor-related protein complex 1, mu 2 subunit
cow(515766) adaptor-related protein complex 1, mu 2 subunit
domestic cat(101095232) adaptor-related protein complex 1, mu 2 subunit
dog(611211) adaptor-related protein complex 1, mu 2 subunit
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005498 Rosetta Predictions human pricing
NM_001108996 Rosetta Predictions rat pricing
XM_345908 Rosetta Predictions rat pricing
NM_001110300 Rosetta Predictions mouse pricing
NM_009678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071753 predicted 914
2 SASI_Hs01_00071754 predicted 654
3 SASI_Hs01_00071755 predicted 1102
4 SASI_Hs01_00071756 predicted 437
5 SASI_Hs01_00071757 predicted 613
6 SASI_Hs01_00071758 predicted 340
7 SASI_Hs01_00071759 predicted 765
8 SASI_Hs02_00339699 predicted 957
9 SASI_Hs01_00071761 predicted 316
10 SASI_Hs01_00071762 predicted 1088
11 SASI_Hs01_00071760 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244144 predicted 1053
2 SASI_Rn02_00244145 predicted 664
3 SASI_Rn02_00244146 predicted 464
4 SASI_Rn02_00244147 predicted 729
5 SASI_Rn02_00244148 predicted 864
6 SASI_Rn02_00244149 predicted 254
7 SASI_Rn02_00244150 predicted 970
8 SASI_Rn02_00244151 predicted 712
9 SASI_Rn02_00244152 predicted 590
10 SASI_Rn02_00244153 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175307 predicted 656
2 SASI_Rn01_00175308 predicted 340
3 SASI_Rn01_00175309 predicted 613
4 SASI_Rn01_00175310 predicted 303
5 SASI_Rn01_00175311 predicted 518
6 SASI_Rn01_00175312 predicted 647
7 SASI_Rn01_00175313 predicted 602
8 SASI_Rn01_00175314 predicted 435
9 SASI_Rn01_00175315 predicted 640
10 SASI_Rn01_00175316 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305296 predicted 393
2 SASI_Mm02_00305297 predicted 340
3 SASI_Mm02_00305298 predicted 244
4 SASI_Mm02_00305299 predicted 1026
5 SASI_Mm02_00305300 predicted 1009
6 SASI_Mm02_00305301 predicted 305
7 SASI_Mm02_00305302 predicted 434
8 SASI_Mm02_00305303 predicted 298
9 SASI_Mm02_00305304 predicted 1093
10 SASI_Mm02_00305305 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316737 predicted 386
2 SASI_Mm02_00316738 predicted 339
3 SASI_Mm02_00316739 predicted 237
4 SASI_Mm02_00316740 predicted 1013
5 SASI_Mm02_00316741 predicted 996
6 SASI_Mm01_00149014 predicted 301
7 SASI_Mm02_00316742 predicted 432
8 SASI_Mm01_00149015 predicted 295
9 SASI_Mm01_00149018 predicted 1086
10 SASI_Mm02_00316743 predicted 1075
11 SASI_Mm01_00149009 predicted 645
12 SASI_Mm01_00149010 predicted 593
13 SASI_Mm01_00149011 predicted 851
14 SASI_Mm01_00149012 predicted 585
15 SASI_Mm01_00149013 predicted 621
16 SASI_Mm01_00149016 predicted 930
17 SASI_Mm01_00149017 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009678
AP1M2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, mu 2 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-293s21c1
Sequence:GTACCGGACCACGCTGAAGAACGCTAATCTCGAGATTAGCGTTCTTCAGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1537s21c1
Sequence:GTACCGGCTTTGTGTCCCACCCTAATTTCTCGAGAAATTAGGGTGGGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1457s21c1
Sequence:GTACCGGAGGGTTAGGGCACTGACTTAACTCGAGTTAAGTCAGTGCCCTAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-249s21c1
Sequence:GTACCGGTGCACTTCCTGTGGATCAAACCTCGAGGTTTGATCCACAGGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009678.1-1480s1c1
Sequence:CCGGCCTTTACCTCTATCAGCCATACTCGAGTATGGCTGATAGAGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1064s1c1
Sequence:CCGGGCCTGAGAAGAATGTTGTCATCTCGAGATGACAACATTCTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1229s1c1
Sequence:CCGGCCAGGTCCGTTACATGAAGATCTCGAGATCTTCATGTAACGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-896s1c1
Sequence:CCGGCGAGTCAGTCATTGAGAAATTCTCGAGAATTTCTCAATGACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-101s1c1
Sequence:CCGGGCCTCTGATTAGCCGAAACTACTCGAGTAGTTTCGGCTAATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009678
AP1M2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, mu 2 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-293s21c1
Sequence:GTACCGGACCACGCTGAAGAACGCTAATCTCGAGATTAGCGTTCTTCAGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1537s21c1
Sequence:GTACCGGCTTTGTGTCCCACCCTAATTTCTCGAGAAATTAGGGTGGGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1457s21c1
Sequence:GTACCGGAGGGTTAGGGCACTGACTTAACTCGAGTTAAGTCAGTGCCCTAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-249s21c1
Sequence:GTACCGGTGCACTTCCTGTGGATCAAACCTCGAGGTTTGATCCACAGGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009678.1-1480s1c1
Sequence:CCGGCCTTTACCTCTATCAGCCATACTCGAGTATGGCTGATAGAGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1064s1c1
Sequence:CCGGGCCTGAGAAGAATGTTGTCATCTCGAGATGACAACATTCTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1229s1c1
Sequence:CCGGCCAGGTCCGTTACATGAAGATCTCGAGATCTTCATGTAACGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-896s1c1
Sequence:CCGGCGAGTCAGTCATTGAGAAATTCTCGAGAATTTCTCAATGACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-101s1c1
Sequence:CCGGGCCTCTGATTAGCCGAAACTACTCGAGTAGTTTCGGCTAATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009678
AP1M2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, mu 2 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-293s21c1
Sequence:GTACCGGACCACGCTGAAGAACGCTAATCTCGAGATTAGCGTTCTTCAGCGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1537s21c1
Sequence:GTACCGGCTTTGTGTCCCACCCTAATTTCTCGAGAAATTAGGGTGGGACACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009678.2-1457s21c1
Sequence:GTACCGGAGGGTTAGGGCACTGACTTAACTCGAGTTAAGTCAGTGCCCTAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009678.2-249s21c1
Sequence:GTACCGGTGCACTTCCTGTGGATCAAACCTCGAGGTTTGATCCACAGGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009678.1-1480s1c1
Sequence:CCGGCCTTTACCTCTATCAGCCATACTCGAGTATGGCTGATAGAGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1064s1c1
Sequence:CCGGGCCTGAGAAGAATGTTGTCATCTCGAGATGACAACATTCTTCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-1229s1c1
Sequence:CCGGCCAGGTCCGTTACATGAAGATCTCGAGATCTTCATGTAACGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-896s1c1
Sequence:CCGGCGAGTCAGTCATTGAGAAATTCTCGAGAATTTCTCAATGACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009678.1-101s1c1
Sequence:CCGGGCCTCTGATTAGCCGAAACTACTCGAGTAGTTTCGGCTAATCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005498
AP1M2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, mu 2 subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-912s1c1
Sequence:CCGGGATCTGGATTGAGTCTGTCATCTCGAGATGACAGACTCAATCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-757s1c1
Sequence:CCGGCGCAGCAAGAACAAATCAGTACTCGAGTACTGATTTGTTCTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-591s1c1
Sequence:CCGGCGAGGTCTTCATTGATGTCATCTCGAGATGACATCAATGAAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-162s1c1
Sequence:CCGGCATGAGCAAGATTGAGCACTTCTCGAGAAGTGCTCAATCTTGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-249s1c1
Sequence:CCGGCCACTTCCTATGGATCAAACACTCGAGTGTTTGATCCATAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005498.3-1500s1c1
Sequence:CCGGCTTCCTCACCTCTTCCTTATTCTCGAGAATAAGGAAGAGGTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1091s1c1
Sequence:CCGGCGGAGAGAAACGTCGTGATTTCTCGAGAAATCACGACGTTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-756s1c1
Sequence:CCGGCCGCAGCAAGAACAAATCAGTCTCGAGACTGATTTGTTCTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1254s1c1
Sequence:CCGGCCAGGTCCGATACATGAAGATCTCGAGATCTTCATGTATCGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-592s1c1
Sequence:CCGGGAGGTCTTCATTGATGTCATACTCGAGTATGACATCAATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-344s1c1
Sequence:CCGGCAATAGAGGTATTCTGCGAATCTCGAGATTCGCAGAATACCTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005498
AP1M2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, mu 2 subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-912s1c1
Sequence:CCGGGATCTGGATTGAGTCTGTCATCTCGAGATGACAGACTCAATCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-757s1c1
Sequence:CCGGCGCAGCAAGAACAAATCAGTACTCGAGTACTGATTTGTTCTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-591s1c1
Sequence:CCGGCGAGGTCTTCATTGATGTCATCTCGAGATGACATCAATGAAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-162s1c1
Sequence:CCGGCATGAGCAAGATTGAGCACTTCTCGAGAAGTGCTCAATCTTGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-249s1c1
Sequence:CCGGCCACTTCCTATGGATCAAACACTCGAGTGTTTGATCCATAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005498.3-1500s1c1
Sequence:CCGGCTTCCTCACCTCTTCCTTATTCTCGAGAATAAGGAAGAGGTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1091s1c1
Sequence:CCGGCGGAGAGAAACGTCGTGATTTCTCGAGAAATCACGACGTTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-756s1c1
Sequence:CCGGCCGCAGCAAGAACAAATCAGTCTCGAGACTGATTTGTTCTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1254s1c1
Sequence:CCGGCCAGGTCCGATACATGAAGATCTCGAGATCTTCATGTATCGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-592s1c1
Sequence:CCGGGAGGTCTTCATTGATGTCATACTCGAGTATGACATCAATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-344s1c1
Sequence:CCGGCAATAGAGGTATTCTGCGAATCTCGAGATTCGCAGAATACCTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005498
AP1M2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, mu 2 subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-912s1c1
Sequence:CCGGGATCTGGATTGAGTCTGTCATCTCGAGATGACAGACTCAATCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-757s1c1
Sequence:CCGGCGCAGCAAGAACAAATCAGTACTCGAGTACTGATTTGTTCTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-591s1c1
Sequence:CCGGCGAGGTCTTCATTGATGTCATCTCGAGATGACATCAATGAAGACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-162s1c1
Sequence:CCGGCATGAGCAAGATTGAGCACTTCTCGAGAAGTGCTCAATCTTGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-249s1c1
Sequence:CCGGCCACTTCCTATGGATCAAACACTCGAGTGTTTGATCCATAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005498.3-1500s1c1
Sequence:CCGGCTTCCTCACCTCTTCCTTATTCTCGAGAATAAGGAAGAGGTGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1091s1c1
Sequence:CCGGCGGAGAGAAACGTCGTGATTTCTCGAGAAATCACGACGTTTCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-756s1c1
Sequence:CCGGCCGCAGCAAGAACAAATCAGTCTCGAGACTGATTTGTTCTTGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-1254s1c1
Sequence:CCGGCCAGGTCCGATACATGAAGATCTCGAGATCTTCATGTATCGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005498.3-592s1c1
Sequence:CCGGGAGGTCTTCATTGATGTCATACTCGAGTATGACATCAATGAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005498.3-344s1c1
Sequence:CCGGCAATAGAGGTATTCTGCGAATCTCGAGATTCGCAGAATACCTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks