EMAIL THIS PAGE TO A FRIEND

AP1S1

adaptor-related protein complex 1, sigma 1 subunit

130 Gene Product Result for
Synonyms: AP19 CLAPS1 MEDNIK SIGMA1A WUGSC:H_DJ0747G18.2
Gene ID:
Human(1174) Summary: The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008]
Mouse(11769) adaptor protein complex AP-1, sigma 1
Rat(360785) adaptor-related protein complex 1, sigma 1 subunit
naked mole-rat(101703538) adaptor-related protein complex 1, sigma 1 subunit
domestic guinea pig(100724571) adaptor-related protein complex 1, sigma 1 subunit
Goat(100861040) adaptor-related protein complex 1, sigma 1 subunit
sheep(101122493) adaptor-related protein complex 1, sigma 1 subunit
Zebrafish(393279) adaptor-related protein complex 1, sigma 1 subunit
cow(768053) adaptor-related protein complex 1, sigma 1 subunit
domestic cat(101081183) adaptor-related protein complex 1, sigma 1 subunit
dog(100688000) adaptor-related protein complex 1, sigma 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001283 Rosetta Predictions human pricing
NM_057089 Rosetta Predictions human pricing
NM_001108331 Rosetta Predictions rat pricing
NM_007457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331519 predicted 721
2 SASI_Hs02_00331520 predicted 882
3 SASI_Hs02_00331521 predicted 724
4 SASI_Hs02_00331522 predicted 877
5 SASI_Hs02_00331523 predicted 958
6 SASI_Hs02_00331524 predicted 879
7 SASI_Hs02_00331525 predicted 716
8 SASI_Hs02_00331526 predicted 728
9 SASI_Hs02_00331527 predicted 696
10 SASI_Hs02_00331528 predicted 196
11 SASI_Hs01_00170125 predicted 237
12 SASI_Hs01_00170126 predicted 190
13 SASI_Hs01_00170127 predicted 462
14 SASI_Hs01_00170128 predicted 107
15 SASI_Hs01_00170129 predicted 439
16 SASI_Hs01_00170130 predicted 287
17 SASI_Hs01_00170131 predicted 210
18 SASI_Hs01_00170132 predicted 81
19 SASI_Hs01_00170133 predicted 333
20 SASI_Hs01_00170134 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132970 predicted 606
2 SASI_Hs01_00132971 predicted 598
3 SASI_Hs01_00132972 predicted 195
4 SASI_Hs01_00132973 predicted 436
5 SASI_Hs01_00132974 predicted 529
6 SASI_Hs01_00132975 predicted 237
7 SASI_Hs01_00132976 predicted 115
8 SASI_Hs01_00132977 predicted 590
9 SASI_Hs01_00132978 predicted 318
10 SASI_Hs01_00132979 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237609 predicted 230
2 SASI_Rn02_00237610 predicted 226
3 SASI_Rn02_00237611 predicted 275
4 SASI_Rn02_00237612 predicted 246
5 SASI_Rn02_00237613 predicted 225
6 SASI_Rn02_00237614 predicted 288
7 SASI_Rn02_00237615 predicted 230
8 SASI_Rn02_00237616 predicted 231
9 SASI_Rn02_00237617 predicted 292
10 SASI_Rn02_00237618 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110970 predicted 652
2 SASI_Mm01_00110967 predicted 358
3 SASI_Mm01_00110968 predicted 288
4 SASI_Mm02_00311645 predicted 210
5 SASI_Mm01_00110971 predicted 343
6 SASI_Mm01_00110972 predicted 224
7 SASI_Mm01_00110973 predicted 728
8 SASI_Mm01_00110974 predicted 330
9 SASI_Mm01_00110975 predicted 258
10 SASI_Mm01_00110976 predicted 239
11 SASI_Mm01_00110969 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001283
VALIDATED
AP1S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 1 subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-407s1c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-294s1c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-221s1c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-247s1c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-186s1c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001283.3-958s21c1
Sequence:GTACCGGTTGTCCTCTCTGTCCCATAACCTCGAGGTTATGGGACAGAGAGGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-488s21c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-302s21c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-267s21c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-375s21c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-328s21c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001283
VALIDATED
AP1S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 1 subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-407s1c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-294s1c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-221s1c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-247s1c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-186s1c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001283.3-958s21c1
Sequence:GTACCGGTTGTCCTCTCTGTCCCATAACCTCGAGGTTATGGGACAGAGAGGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-488s21c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-302s21c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-267s21c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-375s21c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-328s21c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001283
VALIDATED
AP1S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 1 subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-407s1c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-294s1c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-221s1c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001283.2-247s1c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001283.2-186s1c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001283.3-958s21c1
Sequence:GTACCGGTTGTCCTCTCTGTCCCATAACCTCGAGGTTATGGGACAGAGAGGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-488s21c1
Sequence:CCGGCTCCAAGAAGAGTGTGCTGAACTCGAGTTCAGCACACTCTTCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-302s21c1
Sequence:CCGGCCTCTACTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-267s21c1
Sequence:CCGGAGGGACCTCAAAGTTGTCTATCTCGAGATAGACAACTTTGAGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-375s21c1
Sequence:CCGGGAGCTCTTAGACAAATACTTTCTCGAGAAAGTATTTGTCTAAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001283.3-328s21c1
Sequence:CCGGGCCAAGACAATGAGCTCATCACTCGAGTGATGAGCTCATTGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007457
VALIDATED
AP1S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 1 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-654s1c1
Sequence:CCGGCCACCTTACCTACTTTAGAAACTCGAGTTTCTAAAGTAGGTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-341s1c1
Sequence:CCGGCGTATGTGAGTTGGACATCATCTCGAGATGATGTCCAACTCACATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-206s1c1
Sequence:CCGGGAGGGACCTCAAAGTTGTCTACTCGAGTAGACAACTTTGAGGTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-380s1c1
Sequence:CCGGCTACTTTATCCTGGACGAGTTCTCGAGAACTCGTCCAGGATAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007457.1-242s1c1
Sequence:CCGGTCTCTATTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAATAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007457
VALIDATED
AP1S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 1 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-654s1c1
Sequence:CCGGCCACCTTACCTACTTTAGAAACTCGAGTTTCTAAAGTAGGTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-341s1c1
Sequence:CCGGCGTATGTGAGTTGGACATCATCTCGAGATGATGTCCAACTCACATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-206s1c1
Sequence:CCGGGAGGGACCTCAAAGTTGTCTACTCGAGTAGACAACTTTGAGGTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-380s1c1
Sequence:CCGGCTACTTTATCCTGGACGAGTTCTCGAGAACTCGTCCAGGATAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007457.1-242s1c1
Sequence:CCGGTCTCTATTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAATAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007457
VALIDATED
AP1S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 1 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113125    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-654s1c1
Sequence:CCGGCCACCTTACCTACTTTAGAAACTCGAGTTTCTAAAGTAGGTAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-341s1c1
Sequence:CCGGCGTATGTGAGTTGGACATCATCTCGAGATGATGTCCAACTCACATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-206s1c1
Sequence:CCGGGAGGGACCTCAAAGTTGTCTACTCGAGTAGACAACTTTGAGGTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007457.1-380s1c1
Sequence:CCGGCTACTTTATCCTGGACGAGTTCTCGAGAACTCGTCCAGGATAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007457.1-242s1c1
Sequence:CCGGTCTCTATTTCTGCTGCGCCATCTCGAGATGGCGCAGCAGAAATAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)