EMAIL THIS PAGE TO A FRIEND

AP1S2

adaptor-related protein complex 1, sigma 2 subunit

131 Gene Product Result for
Synonyms: MGC:1902 MRX59 MRXS21 MRXSF SIGMA1B
UniProtKB ID: P56377, O95326, Q9H2N6
Gene ID:
Human(8905) Summary: Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as the small subunit of this complex and is a member of the adaptin protein family. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(108012) adaptor-related protein complex 1, sigma 2 subunit
Rat(302671) adaptor-related protein complex 1, sigma 2 subunit
Zebrafish(327237) adaptor-related protein complex 1, sigma 2 subunit
chicken(418621) adaptor-related protein complex 1, sigma 2 subunit
domestic cat(101096540) adaptor-related protein complex 1, sigma 2 subunit
cow(616331) adaptor-related protein complex 1, sigma 2 subunit
dog(611468) AP-1 complex subunit sigma-2-like
sheep(101104633) adaptor-related protein complex 1, sigma 2 subunit
domestic guinea pig(100732251) adaptor-related protein complex 1, sigma 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003916 Rosetta Predictions human pricing
NM_001127531 Rosetta Predictions rat pricing
NM_026887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180297 predicted 575
2 SASI_Hs01_00180300 predicted 932
3 SASI_Hs01_00180303 predicted 845
4 SASI_Hs02_00336553 predicted 856
5 SASI_Hs02_00336554 predicted 830
6 SASI_Hs02_00336555 predicted 1014
7 SASI_Hs02_00336556 predicted 842
8 SASI_Hs01_00180298 predicted 464
9 SASI_Hs01_00180299 predicted 749
10 SASI_Hs01_00180301 predicted 525
11 SASI_Hs01_00180302 predicted 546
12 SASI_Hs01_00180304 predicted 1032
13 SASI_Hs01_00180305 predicted 587
14 SASI_Hs01_00180306 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254063 predicted 1034
2 SASI_Rn02_00254064 predicted 348
3 SASI_Rn02_00254065 predicted 955
4 SASI_Rn02_00254066 predicted 1078
5 SASI_Rn02_00254067 predicted 358
6 SASI_Rn02_00254068 predicted 378
7 SASI_Rn02_00254069 predicted 1018
8 SASI_Rn02_00254070 predicted 978
9 SASI_Rn02_00254071 predicted 1066
10 SASI_Rn02_00254072 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113530 predicted 719
2 SASI_Mm01_00113531 predicted 288
3 SASI_Mm02_00331149 predicted 864
4 SASI_Mm01_00113533 predicted 731
5 SASI_Mm01_00113534 predicted 816
6 SASI_Mm01_00113535 predicted 764
7 SASI_Mm01_00113536 predicted 370
8 SASI_Mm01_00113537 predicted 372
9 SASI_Mm01_00113538 predicted 833
10 SASI_Mm01_00113539 predicted 203
11 SASI_Mm01_00113532 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003916
VALIDATED
AP1S2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 2 subunit
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1109s21c1
Sequence:GTACCGGTGACAAAGGAAACTCTTAAATCTCGAGATTTAAGAGTTTCCTTTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-707s21c1
Sequence:GTACCGGACTGCAGGAGGAAGCTGAAACCTCGAGGTTTCAGCTTCCTCCTGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-443s21c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-729s21c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-350s21c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-574s21c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1203s21c1
Sequence:GTACCGGGGGAATTGACATGTCACATATCTCGAGATATGTGACATGTCAATTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003916.3-852s21c1
Sequence:GTACCGGGATGATGTCTTGTCAGTATTACTCGAGTAATACTGACAAGACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-762s21c1
Sequence:GTACCGGTAACTCTCCTCCCTTGTTGATCTCGAGATCAACAAGGGAGGAGAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-527s1c1
Sequence:CCGGCCTGGAAATAATTCATCGTTACTCGAGTAACGATGAATTATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-443s1c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-350s1c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-574s1c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-729s1c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003916
VALIDATED
AP1S2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 2 subunit
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1109s21c1
Sequence:GTACCGGTGACAAAGGAAACTCTTAAATCTCGAGATTTAAGAGTTTCCTTTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-707s21c1
Sequence:GTACCGGACTGCAGGAGGAAGCTGAAACCTCGAGGTTTCAGCTTCCTCCTGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-443s21c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-729s21c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-350s21c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-574s21c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1203s21c1
Sequence:GTACCGGGGGAATTGACATGTCACATATCTCGAGATATGTGACATGTCAATTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003916.3-852s21c1
Sequence:GTACCGGGATGATGTCTTGTCAGTATTACTCGAGTAATACTGACAAGACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-762s21c1
Sequence:GTACCGGTAACTCTCCTCCCTTGTTGATCTCGAGATCAACAAGGGAGGAGAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-527s1c1
Sequence:CCGGCCTGGAAATAATTCATCGTTACTCGAGTAACGATGAATTATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-443s1c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-350s1c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-574s1c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-729s1c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003916
VALIDATED
AP1S2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 2 subunit
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1109s21c1
Sequence:GTACCGGTGACAAAGGAAACTCTTAAATCTCGAGATTTAAGAGTTTCCTTTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-707s21c1
Sequence:GTACCGGACTGCAGGAGGAAGCTGAAACCTCGAGGTTTCAGCTTCCTCCTGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-443s21c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-729s21c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-350s21c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003916.3-574s21c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-1203s21c1
Sequence:GTACCGGGGGAATTGACATGTCACATATCTCGAGATATGTGACATGTCAATTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003916.3-852s21c1
Sequence:GTACCGGGATGATGTCTTGTCAGTATTACTCGAGTAATACTGACAAGACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003916.3-762s21c1
Sequence:GTACCGGTAACTCTCCTCCCTTGTTGATCTCGAGATCAACAAGGGAGGAGAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-527s1c1
Sequence:CCGGCCTGGAAATAATTCATCGTTACTCGAGTAACGATGAATTATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-443s1c1
Sequence:CCGGGCGAGATCTGAAGATTGTTTACTCGAGTAAACAATCTTCAGATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-350s1c1
Sequence:CCGGCCCACTATCAGACAAAGAGAACTCGAGTTCTCTTTGTCTGATAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-574s1c1
Sequence:CCGGGCAGTGTCTGTGAACTAGATACTCGAGTATCTAGTTCACAGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003916.3-729s1c1
Sequence:CCGGCCACGTAGTGTTCTTGAAGAACTCGAGTTCTTCAAGAACACTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026887
VALIDATED
AP1S2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 2 subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-407s21c1
Sequence:CCGGGTGAACTTGATATCATCTTTACTCGAGTAAAGATGATATCAAGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026887.2-563s21c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-372s21c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-2304s21c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-320s21c1
Sequence:CCGGCTATTGAGGATCAGGACAATGCTCGAGCATTGTCCTGATCCTCAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-2304s1c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-351s1c1
Sequence:CCGGCCTGGAAATAATCCATCGTTACTCGAGTAACGATGGATTATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-562s1c1
Sequence:CCGGAGCAAGAGTTTCATTGGGTATCTCGAGATACCCAATGAAACTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-372s1c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-563s1c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026887
VALIDATED
AP1S2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 2 subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-407s21c1
Sequence:CCGGGTGAACTTGATATCATCTTTACTCGAGTAAAGATGATATCAAGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026887.2-563s21c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-372s21c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-2304s21c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-320s21c1
Sequence:CCGGCTATTGAGGATCAGGACAATGCTCGAGCATTGTCCTGATCCTCAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-2304s1c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-351s1c1
Sequence:CCGGCCTGGAAATAATCCATCGTTACTCGAGTAACGATGGATTATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-562s1c1
Sequence:CCGGAGCAAGAGTTTCATTGGGTATCTCGAGATACCCAATGAAACTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-372s1c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-563s1c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026887
VALIDATED
AP1S2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 2 subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-407s21c1
Sequence:CCGGGTGAACTTGATATCATCTTTACTCGAGTAAAGATGATATCAAGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026887.2-563s21c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-372s21c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-2304s21c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026887.2-320s21c1
Sequence:CCGGCTATTGAGGATCAGGACAATGCTCGAGCATTGTCCTGATCCTCAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-2304s1c1
Sequence:CCGGGCCACATTTATGCAGTGTCAACTCGAGTTGACACTGCATAAATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-351s1c1
Sequence:CCGGCCTGGAAATAATCCATCGTTACTCGAGTAACGATGGATTATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-562s1c1
Sequence:CCGGAGCAAGAGTTTCATTGGGTATCTCGAGATACCCAATGAAACTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026887.2-372s1c1
Sequence:CCGGCGTGGAATTACTTGACAAGTACTCGAGTACTTGTCAAGTAATTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026887.2-563s1c1
Sequence:CCGGGCAAGAGTTTCATTGGGTATACTCGAGTATACCCAATGAAACTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)