EMAIL THIS PAGE TO A FRIEND

AP1S3

adaptor-related protein complex 1, sigma 3 subunit

98 Gene Product Result for
UniProtKB ID: Q96PC3, B4DQZ1, Q8WTY1, Q96DD1
Gene ID:
Mouse(252903) adaptor-related protein complex AP-1, sigma 3
Rat(367304) adaptor-related protein complex 1, sigma 3 subunit
naked mole-rat(101698822) adaptor-related protein complex 1, sigma 3 subunit
domestic guinea pig(100718917) adaptor-related protein complex 1, sigma 3 subunit
sheep(101117145) adaptor-related protein complex 1, sigma 3 subunit
chicken(424807) adaptor-related protein complex 1, sigma 3 subunit
cow(540693) adaptor-related protein complex 1, sigma 3 subunit
dog(478929) adaptor-related protein complex 1, sigma 3 subunit
domestic cat(101084726) adaptor-related protein complex 1, sigma 3 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178814 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039569 Rosetta Predictions human pricing
NM_183027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182760 predicted 378
2 SASI_Hs01_00182761 predicted 207
3 SASI_Hs01_00182762 predicted 548
4 SASI_Hs01_00182763 predicted 471
5 SASI_Hs01_00182764 predicted 445
6 SASI_Hs01_00182765 predicted 484
7 SASI_Hs01_00182766 predicted 435
8 SASI_Hs01_00182767 predicted 389
9 SASI_Hs01_00182768 predicted 180
10 SASI_Hs01_00182769 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099128 predicted 720
2 SASI_Mm01_00099129 predicted 800
3 SASI_Mm01_00099130 predicted 744
4 SASI_Mm01_00099131 predicted 512
5 SASI_Mm01_00099133 predicted 700
6 SASI_Mm01_00099134 predicted 202
7 SASI_Mm01_00099135 predicted 583
8 SASI_Mm01_00099136 predicted 689
9 SASI_Mm01_00099137 predicted 750
10 SASI_Mm02_00350027 predicted 382
11 SASI_Mm01_00099132 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178814
VALIDATED
AP1S3 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 3 subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-193s1c1
Sequence:CCGGCGGGAAATTGTTCAGATTATTCTCGAGAATAATCTGAACAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-124s1c1
Sequence:CCGGCGACAAGGGAAATTACGGCTACTCGAGTAGCCGTAATTTCCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178814.2-319s1c1
Sequence:CCGGGACAATGAGCTCTTGACGCTACTCGAGTAGCGTCAAGAGCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-153s1c1
Sequence:CCGGGTACATCACTCTCCCTGATAACTCGAGTTATCAGGGAGAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-335s1c1
Sequence:CCGGCGCTAGAGATTGTGCATCGTTCTCGAGAACGATGCACAATCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178814
VALIDATED
AP1S3 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 3 subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-193s1c1
Sequence:CCGGCGGGAAATTGTTCAGATTATTCTCGAGAATAATCTGAACAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-124s1c1
Sequence:CCGGCGACAAGGGAAATTACGGCTACTCGAGTAGCCGTAATTTCCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178814.2-319s1c1
Sequence:CCGGGACAATGAGCTCTTGACGCTACTCGAGTAGCGTCAAGAGCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-153s1c1
Sequence:CCGGGTACATCACTCTCCCTGATAACTCGAGTTATCAGGGAGAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-335s1c1
Sequence:CCGGCGCTAGAGATTGTGCATCGTTCTCGAGAACGATGCACAATCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178814
VALIDATED
AP1S3 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 3 subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-193s1c1
Sequence:CCGGCGGGAAATTGTTCAGATTATTCTCGAGAATAATCTGAACAATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-124s1c1
Sequence:CCGGCGACAAGGGAAATTACGGCTACTCGAGTAGCCGTAATTTCCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178814.2-319s1c1
Sequence:CCGGGACAATGAGCTCTTGACGCTACTCGAGTAGCGTCAAGAGCTCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-153s1c1
Sequence:CCGGGTACATCACTCTCCCTGATAACTCGAGTTATCAGGGAGAGTGATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_178814.2-335s1c1
Sequence:CCGGCGCTAGAGATTGTGCATCGTTCTCGAGAACGATGCACAATCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183027
AP1S3 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 1, sigma 3 subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183027.1-1786s1c1
Sequence:CCGGGCTGCCTGTATTGTAGCATTTCTCGAGAAATGCTACAATACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-537s1c1
Sequence:CCGGCTGATATGTTACAAGAGACAACTCGAGTTGTCTCTTGTAACATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-394s1c1
Sequence:CCGGGCTGGATAAATACTTTGGAAACTCGAGTTTCCAAAGTATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-282s1c1
Sequence:CCGGAGGAGCTGAAACTTGTTTATACTCGAGTATAAACAAGTTTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-420s1c1
Sequence:CCGGGTGAGCTGGATATTATCTTTACTCGAGTAAAGATAATATCCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183027.2-617s21c1
Sequence:CCGGCCATGCTGTGAACCTACAAACCTCGAGGTTTGTAGGTTCACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-361s21c1
Sequence:CCGGCTAGAGATTGTTCATCGTTATCTCGAGATAACGATGAACAATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-207s21c1
Sequence:CCGGGAAGATCACCCGCGACATCATCTCGAGATGATGTCGCGGGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183027
AP1S3 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 1, sigma 3 subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183027.1-1786s1c1
Sequence:CCGGGCTGCCTGTATTGTAGCATTTCTCGAGAAATGCTACAATACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-537s1c1
Sequence:CCGGCTGATATGTTACAAGAGACAACTCGAGTTGTCTCTTGTAACATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-394s1c1
Sequence:CCGGGCTGGATAAATACTTTGGAAACTCGAGTTTCCAAAGTATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-282s1c1
Sequence:CCGGAGGAGCTGAAACTTGTTTATACTCGAGTATAAACAAGTTTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-420s1c1
Sequence:CCGGGTGAGCTGGATATTATCTTTACTCGAGTAAAGATAATATCCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183027.2-617s21c1
Sequence:CCGGCCATGCTGTGAACCTACAAACCTCGAGGTTTGTAGGTTCACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-361s21c1
Sequence:CCGGCTAGAGATTGTTCATCGTTATCTCGAGATAACGATGAACAATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-207s21c1
Sequence:CCGGGAAGATCACCCGCGACATCATCTCGAGATGATGTCGCGGGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183027
AP1S3 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 1, sigma 3 subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183027.1-1786s1c1
Sequence:CCGGGCTGCCTGTATTGTAGCATTTCTCGAGAAATGCTACAATACAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-537s1c1
Sequence:CCGGCTGATATGTTACAAGAGACAACTCGAGTTGTCTCTTGTAACATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-394s1c1
Sequence:CCGGGCTGGATAAATACTTTGGAAACTCGAGTTTCCAAAGTATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-282s1c1
Sequence:CCGGAGGAGCTGAAACTTGTTTATACTCGAGTATAAACAAGTTTCAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183027.1-420s1c1
Sequence:CCGGGTGAGCTGGATATTATCTTTACTCGAGTAAAGATAATATCCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183027.2-617s21c1
Sequence:CCGGCCATGCTGTGAACCTACAAACCTCGAGGTTTGTAGGTTCACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-361s21c1
Sequence:CCGGCTAGAGATTGTTCATCGTTATCTCGAGATAACGATGAACAATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183027.2-207s21c1
Sequence:CCGGGAAGATCACCCGCGACATCATCTCGAGATGATGTCGCGGGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks