EMAIL THIS PAGE TO A FRIEND

AP2A1

adaptor-related protein complex 2, alpha 1 subunit

102 Gene Product Result for
Synonyms: ADTAA AP2-ALPHA CLAPA1
UniProtKB ID: O95782, Q96CI7, Q96PP6, Q96PP7, Q9H070
Gene ID:
Human(160) Summary: This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(11771) adaptor-related protein complex 2, alpha 1 subunit
Rat(308578) adaptor-related protein complex 2, alpha 1 subunit
sheep(101108595) adaptor-related protein complex 2, alpha 1 subunit
Domestic Rabbit(100344131) adaptor-related protein complex 2, alpha 1 subunit
domestic guinea pig(100723156) adaptor-related protein complex 2, alpha 1 subunit
naked mole-rat(101715441) adaptor-related protein complex 2, alpha 1 subunit
Zebrafish(558153) adaptor-related protein complex 2, alpha 1 subunit
dog(484375) adaptor-related protein complex 2, alpha 1 subunit
Horse(100056103) adaptor-related protein complex 2, alpha 1 subunit
domestic cat(101101430) adaptor-related protein complex 2, alpha 1 subunit
cow(784636) adaptor-related protein complex 2, alpha 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014203 Rosetta Predictions human pricing
NM_130787 Rosetta Predictions human pricing
NM_001107511 Rosetta Predictions rat pricing
NM_001077264 Rosetta Predictions mouse pricing
NM_007458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034069 predicted 448
2 SASI_Hs01_00034070 predicted 1147
3 SASI_Hs01_00034071 predicted 323
4 SASI_Hs01_00034072 predicted 1527
5 SASI_Hs01_00034073 predicted 319
6 SASI_Hs01_00034074 predicted 1317
7 SASI_Hs01_00034075 predicted 2804
8 SASI_Hs01_00034076 predicted 1406
9 SASI_Hs01_00034077 predicted 1568
10 SASI_Hs01_00034078 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011408 predicted 452
2 SASI_Hs01_00011409 predicted 1150
3 SASI_Hs01_00011410 predicted 327
4 SASI_Hs01_00011411 predicted 1523
5 SASI_Hs01_00011412 predicted 323
6 SASI_Hs01_00011413 predicted 1312
7 SASI_Hs01_00011414 predicted 2746
8 SASI_Hs01_00011415 predicted 1409
9 SASI_Hs01_00011416 predicted 1568
10 SASI_Hs01_00011417 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229545 predicted 368
2 SASI_Rn02_00229546 predicted 207
3 SASI_Rn02_00229547 predicted 395
4 SASI_Rn02_00229548 predicted 2354
5 SASI_Rn02_00229549 predicted 299
6 SASI_Rn02_00229550 predicted 264
7 SASI_Rn02_00229551 predicted 1040
8 SASI_Rn02_00229552 predicted 1791
9 SASI_Rn02_00229553 predicted 2316
10 SASI_Rn02_00229554 predicted 2898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292442 predicted 218
2 SASI_Mm02_00292443 predicted 1572
3 SASI_Mm02_00292444 predicted 286
4 SASI_Mm02_00292445 predicted 219
5 SASI_Mm02_00292446 predicted 1384
6 SASI_Mm02_00292447 predicted 1048
7 SASI_Mm02_00292448 predicted 1614
8 SASI_Mm02_00292449 predicted 318
9 SASI_Mm02_00292450 predicted 2848
10 SASI_Mm02_00292451 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159925 predicted 217
2 SASI_Mm01_00159926 predicted 1565
3 SASI_Mm01_00159927 predicted 281
4 SASI_Mm01_00159928 predicted 221
5 SASI_Mm01_00159929 predicted 1382
6 SASI_Mm01_00159930 predicted 1049
7 SASI_Mm01_00159931 predicted 1609
8 SASI_Mm01_00159932 predicted 316
9 SASI_Mm01_00159933 predicted 2907
10 SASI_Mm01_00159934 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014203
VALIDATED
AP2A1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, alpha 1 subunit
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2906s21c1
Sequence:GTACCGGATGGACGCAGAAGTTACTAAGCTCGAGCTTAGTAACTTCTGCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014203.2-3234s21c1
Sequence:GTACCGGGACAGAGAAGACACCAGGGTTCTCGAGAACCCTGGTGTCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2564s21c1
Sequence:GTACCGGTCGGTGCAGTTCCAGAATTTCCTCGAGGAAATTCTGGAACTGCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-263s21c1
Sequence:GTACCGGTCCGACATCCGGAACTGTAAGCTCGAGCTTACAGTTCCGGATGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-283s21c1
Sequence:CCGGGAGCAAAGAGGCGGAAATTAACTCGAGTTAATTTCCGCCTCTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-541s21c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-1315s21c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-3222s21c1
Sequence:CCGGACCTCCACTGGTGACAGAGAACTCGAGTTCTCTGTCACCAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2428s21c1
Sequence:GTACCGGAGCCGATGAGTTGCTGAATAACTCGAGTTATTCAGCAACTCATCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-356s21c1
Sequence:GTACCGGGCCTTGGATGGCTACAGTAAGCTCGAGCTTACTGTAGCCATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2532s21c1
Sequence:GTACCGGGCCGCATGTATCTCTTCTATGCTCGAGCATAGAAGAGATACATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-2440s1c1
Sequence:CCGGGCTGAATAAGTTTGTGTGTAACTCGAGTTACACACAAACTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-2911s1c1
Sequence:CCGGCGCAGAAGTTACTAAGGCCAACTCGAGTTGGCCTTAGTAACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-541s1c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-484s1c1
Sequence:CCGGGCAAATAGGTTACCTGTTCATCTCGAGATGAACAGGTAACCTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-1315s1c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014203
VALIDATED
AP2A1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, alpha 1 subunit
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2906s21c1
Sequence:GTACCGGATGGACGCAGAAGTTACTAAGCTCGAGCTTAGTAACTTCTGCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014203.2-3234s21c1
Sequence:GTACCGGGACAGAGAAGACACCAGGGTTCTCGAGAACCCTGGTGTCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2564s21c1
Sequence:GTACCGGTCGGTGCAGTTCCAGAATTTCCTCGAGGAAATTCTGGAACTGCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-263s21c1
Sequence:GTACCGGTCCGACATCCGGAACTGTAAGCTCGAGCTTACAGTTCCGGATGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-283s21c1
Sequence:CCGGGAGCAAAGAGGCGGAAATTAACTCGAGTTAATTTCCGCCTCTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-541s21c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-1315s21c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-3222s21c1
Sequence:CCGGACCTCCACTGGTGACAGAGAACTCGAGTTCTCTGTCACCAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2428s21c1
Sequence:GTACCGGAGCCGATGAGTTGCTGAATAACTCGAGTTATTCAGCAACTCATCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-356s21c1
Sequence:GTACCGGGCCTTGGATGGCTACAGTAAGCTCGAGCTTACTGTAGCCATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2532s21c1
Sequence:GTACCGGGCCGCATGTATCTCTTCTATGCTCGAGCATAGAAGAGATACATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-2440s1c1
Sequence:CCGGGCTGAATAAGTTTGTGTGTAACTCGAGTTACACACAAACTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-2911s1c1
Sequence:CCGGCGCAGAAGTTACTAAGGCCAACTCGAGTTGGCCTTAGTAACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-541s1c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-484s1c1
Sequence:CCGGGCAAATAGGTTACCTGTTCATCTCGAGATGAACAGGTAACCTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-1315s1c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014203
VALIDATED
AP2A1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, alpha 1 subunit
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2906s21c1
Sequence:GTACCGGATGGACGCAGAAGTTACTAAGCTCGAGCTTAGTAACTTCTGCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014203.2-3234s21c1
Sequence:GTACCGGGACAGAGAAGACACCAGGGTTCTCGAGAACCCTGGTGTCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2564s21c1
Sequence:GTACCGGTCGGTGCAGTTCCAGAATTTCCTCGAGGAAATTCTGGAACTGCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-263s21c1
Sequence:GTACCGGTCCGACATCCGGAACTGTAAGCTCGAGCTTACAGTTCCGGATGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-283s21c1
Sequence:CCGGGAGCAAAGAGGCGGAAATTAACTCGAGTTAATTTCCGCCTCTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-541s21c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-1315s21c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014203.2-3222s21c1
Sequence:CCGGACCTCCACTGGTGACAGAGAACTCGAGTTCTCTGTCACCAGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2428s21c1
Sequence:GTACCGGAGCCGATGAGTTGCTGAATAACTCGAGTTATTCAGCAACTCATCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-356s21c1
Sequence:GTACCGGGCCTTGGATGGCTACAGTAAGCTCGAGCTTACTGTAGCCATCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014203.2-2532s21c1
Sequence:GTACCGGGCCGCATGTATCTCTTCTATGCTCGAGCATAGAAGAGATACATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-2440s1c1
Sequence:CCGGGCTGAATAAGTTTGTGTGTAACTCGAGTTACACACAAACTTATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-2911s1c1
Sequence:CCGGCGCAGAAGTTACTAAGGCCAACTCGAGTTGGCCTTAGTAACTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-541s1c1
Sequence:CCGGCCTCATCAACAACGCCATCAACTCGAGTTGATGGCGTTGTTGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014203.2-484s1c1
Sequence:CCGGGCAAATAGGTTACCTGTTCATCTCGAGATGAACAGGTAACCTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014203.2-1315s1c1
Sequence:CCGGGCACATTGACACCGTCATCAACTCGAGTTGATGACGGTGTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007458
VALIDATED
AP2A1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, alpha 1 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-384s21c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-1066s21c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-2994s21c1
Sequence:CCGGGGCCCAAATGTACCGTCTAACCTCGAGGTTAGACGGTACATTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007458.2-876s21c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-3082s21c1
Sequence:CCGGCTGGACTTGCCCTGGTATATGCTCGAGCATATACCAGGGCAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-937s1c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-445s1c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-1127s1c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-850s1c1
Sequence:CCGGCAAGAAGAATCCGGATGACTTCTCGAGAAGTCATCCGGATTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007458
VALIDATED
AP2A1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, alpha 1 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-384s21c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-1066s21c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-2994s21c1
Sequence:CCGGGGCCCAAATGTACCGTCTAACCTCGAGGTTAGACGGTACATTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007458.2-876s21c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-3082s21c1
Sequence:CCGGCTGGACTTGCCCTGGTATATGCTCGAGCATATACCAGGGCAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-937s1c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-445s1c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-1127s1c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-850s1c1
Sequence:CCGGCAAGAAGAATCCGGATGACTTCTCGAGAAGTCATCCGGATTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007458
VALIDATED
AP2A1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, alpha 1 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-384s21c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-1066s21c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-2994s21c1
Sequence:CCGGGGCCCAAATGTACCGTCTAACCTCGAGGTTAGACGGTACATTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007458.2-876s21c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007458.2-3082s21c1
Sequence:CCGGCTGGACTTGCCCTGGTATATGCTCGAGCATATACCAGGGCAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-937s1c1
Sequence:CCGGCCAGGACTACACTTACTACTTCTCGAGAAGTAGTAAGTGTAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-445s1c1
Sequence:CCGGGAACCTGCTAAGCTCTAACAACTCGAGTTGTTAGAGCTTAGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-1127s1c1
Sequence:CCGGGCTATCCTCTTTGAGACCATTCTCGAGAATGGTCTCAAAGAGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007458.1-850s1c1
Sequence:CCGGCAAGAAGAATCCGGATGACTTCTCGAGAAGTCATCCGGATTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks