EMAIL THIS PAGE TO A FRIEND

AP2A2

adaptor-related protein complex 2, alpha 2 subunit

Synonyms: ADTAB CLAPA2 HIP-9 HIP9 HYPJ
UniProtKB ID: O94973, O75403, Q53ET1, Q96SI8
Gene ID:
Mouse(11772) adaptor-related protein complex 2, alpha 2 subunit
Rat(81637) adaptor-related protein complex 2, alpha 2 subunit
chicken(423102) adaptor-related protein complex 2, alpha 2 subunit
dog(475994) adaptor-related protein complex 2, alpha 2 subunit
cow(515216) adaptor-related protein complex 2, alpha 2 subunit
domestic cat(101097097) adaptor-related protein complex 2, alpha 2 subunit
naked mole-rat(101719967) adaptor-related protein complex 2, alpha 2 subunit
domestic guinea pig(100715549) adaptor-related protein complex 2, alpha 2 subunit
sheep(101121898) adaptor-related protein complex 2, alpha 2 subunit
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012305 Rosetta Predictions human pricing
NM_031008 Rosetta Predictions rat pricing
NM_007459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213143 predicted 2647
2 SASI_Hs01_00213144 predicted 1529
3 SASI_Hs01_00213145 predicted 1424
4 SASI_Hs01_00213146 predicted 2786
5 SASI_Hs01_00213147 predicted 1086
6 SASI_Hs01_00213148 predicted 1500
7 SASI_Hs01_00213149 predicted 1270
8 SASI_Hs01_00213150 predicted 824
9 SASI_Hs01_00213151 predicted 1292
10 SASI_Hs01_00213152 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063350 predicted 252
2 SASI_Rn02_00264197 predicted 368
3 SASI_Rn01_00063351 predicted 967
4 SASI_Rn01_00063353 predicted 2260
5 SASI_Rn02_00264198 predicted 2440
6 SASI_Rn01_00063354 predicted 1321
7 SASI_Rn01_00063357 predicted 2867
8 SASI_Rn01_00063358 predicted 1552
9 SASI_Rn01_00063359 predicted 330
10 SASI_Rn02_00264199 predicted 2304
11 SASI_Rn01_00063352 predicted 2387
12 SASI_Rn01_00063355 predicted 719
13 SASI_Rn01_00063356 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116920 predicted 290
2 SASI_Mm01_00116923 predicted 298
3 SASI_Mm02_00311646 predicted 504
4 SASI_Mm01_00116924 predicted 2355
5 SASI_Mm01_00116927 predicted 1647
6 SASI_Mm01_00116928 predicted 351
7 SASI_Mm02_00311647 predicted 468
8 SASI_Mm02_00311648 predicted 1396
9 SASI_Mm02_00311649 predicted 1123
10 SASI_Mm02_00311650 predicted 704
11 SASI_Mm01_00116921 predicted 231
12 SASI_Mm01_00116922 predicted 239
13 SASI_Mm01_00116925 predicted 1437
14 SASI_Mm01_00116926 predicted 2473
15 SASI_Mm01_00116929 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012305
VALIDATED
AP2A2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, alpha 2 subunit
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-873s1c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012305.1-315s1c1
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-1527s1c1
Sequence:CCGGCCGAGTCATTCAGATCGTCATCTCGAGATGACGATCTGAATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2337s1c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2812s1c1
Sequence:CCGGGCTGGAATCATCCACACGAAACTCGAGTTTCGTGTGGATGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3041s21c1
Sequence:GTACCGGTCTTCGTCTGTGCCGTTTGTCCTCGAGGACAAACGGCACAGACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3288s21c1
Sequence:GTACCGGGAAATTAGAAGTTGGCGTGAACTCGAGTTCACGCCAACTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-913s21c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2377s21c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-355s21c2
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2824s21c1
Sequence:CCGGTGATCCTAATCCTGCGAATTTCTCGAGAAATTCGCAGGATTAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3253s21c1
Sequence:GTACCGGGAGACAGTTCTGTGGTTAAATCTCGAGATTTAACCACAGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-326s21c1
Sequence:GTACCGGGCTCTTGATGGCTATAGTAAACTCGAGTTTACTATAGCCATCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-1525s21c1
Sequence:GTACCGGGATCCGAATTGCTGGTGATTACTCGAGTAATCACCAGCAATTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3221s21c1
Sequence:GTACCGGGGTGGATCTTGGGATCAATTTCTCGAGAAATTGATCCCAAGATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-220s21c1
Sequence:GTACCGGGGCGGTCTTCATCTCGGATATCTCGAGATATCCGAGATGAAGACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012305
VALIDATED
AP2A2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, alpha 2 subunit
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-873s1c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012305.1-315s1c1
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-1527s1c1
Sequence:CCGGCCGAGTCATTCAGATCGTCATCTCGAGATGACGATCTGAATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2337s1c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2812s1c1
Sequence:CCGGGCTGGAATCATCCACACGAAACTCGAGTTTCGTGTGGATGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3041s21c1
Sequence:GTACCGGTCTTCGTCTGTGCCGTTTGTCCTCGAGGACAAACGGCACAGACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3288s21c1
Sequence:GTACCGGGAAATTAGAAGTTGGCGTGAACTCGAGTTCACGCCAACTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-913s21c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2377s21c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-355s21c2
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2824s21c1
Sequence:CCGGTGATCCTAATCCTGCGAATTTCTCGAGAAATTCGCAGGATTAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3253s21c1
Sequence:GTACCGGGAGACAGTTCTGTGGTTAAATCTCGAGATTTAACCACAGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-326s21c1
Sequence:GTACCGGGCTCTTGATGGCTATAGTAAACTCGAGTTTACTATAGCCATCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-1525s21c1
Sequence:GTACCGGGATCCGAATTGCTGGTGATTACTCGAGTAATCACCAGCAATTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3221s21c1
Sequence:GTACCGGGGTGGATCTTGGGATCAATTTCTCGAGAAATTGATCCCAAGATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-220s21c1
Sequence:GTACCGGGGCGGTCTTCATCTCGGATATCTCGAGATATCCGAGATGAAGACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012305
VALIDATED
AP2A2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, alpha 2 subunit
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-873s1c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012305.1-315s1c1
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-1527s1c1
Sequence:CCGGCCGAGTCATTCAGATCGTCATCTCGAGATGACGATCTGAATGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2337s1c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012305.1-2812s1c1
Sequence:CCGGGCTGGAATCATCCACACGAAACTCGAGTTTCGTGTGGATGATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3041s21c1
Sequence:GTACCGGTCTTCGTCTGTGCCGTTTGTCCTCGAGGACAAACGGCACAGACGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3288s21c1
Sequence:GTACCGGGAAATTAGAAGTTGGCGTGAACTCGAGTTCACGCCAACTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-913s21c1
Sequence:CCGGCCAGGATTACACTTACTATTTCTCGAGAAATAGTAAGTGTAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2377s21c1
Sequence:CCGGGCAGAATTTAGGTCGGATGTTCTCGAGAACATCCGACCTAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-355s21c2
Sequence:CCGGCGTCTGCAAGTTGCTCTTCATCTCGAGATGAAGAGCAACTTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_012305.2-2824s21c1
Sequence:CCGGTGATCCTAATCCTGCGAATTTCTCGAGAAATTCGCAGGATTAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3253s21c1
Sequence:GTACCGGGAGACAGTTCTGTGGTTAAATCTCGAGATTTAACCACAGAACTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-326s21c1
Sequence:GTACCGGGCTCTTGATGGCTATAGTAAACTCGAGTTTACTATAGCCATCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-1525s21c1
Sequence:GTACCGGGATCCGAATTGCTGGTGATTACTCGAGTAATCACCAGCAATTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012305.2-3221s21c1
Sequence:GTACCGGGGTGGATCTTGGGATCAATTTCTCGAGAAATTGATCCCAAGATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012305.2-220s21c1
Sequence:GTACCGGGGCGGTCTTCATCTCGGATATCTCGAGATATCCGAGATGAAGACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007459
VALIDATED
AP2A2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, alpha 2 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007459.3-2380s21c1
Sequence:CCGGTTAGGCCGAATGTTCATATTTCTCGAGAAATATGAACATTCGGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-2528s21c1
Sequence:CCGGTGCAACAAGTGGTCAACATTGCTCGAGCAATGTTGACCACTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-497s21c1
Sequence:CCGGGTGAACTGATCCGGTTGATTACTCGAGTAATCAACCGGATCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-3658s21c1
Sequence:CCGGTCCTATCCCTATGGTACATTCCTCGAGGAATGTACCATAGGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-1608s21c1
Sequence:CCGGCTATGCTGCCAAGACGGTATTCTCGAGAATACCGTCTTGGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007459
VALIDATED
AP2A2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, alpha 2 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007459.3-2380s21c1
Sequence:CCGGTTAGGCCGAATGTTCATATTTCTCGAGAAATATGAACATTCGGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-2528s21c1
Sequence:CCGGTGCAACAAGTGGTCAACATTGCTCGAGCAATGTTGACCACTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-497s21c1
Sequence:CCGGGTGAACTGATCCGGTTGATTACTCGAGTAATCAACCGGATCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-3658s21c1
Sequence:CCGGTCCTATCCCTATGGTACATTCCTCGAGGAATGTACCATAGGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-1608s21c1
Sequence:CCGGCTATGCTGCCAAGACGGTATTCTCGAGAATACCGTCTTGGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007459
VALIDATED
AP2A2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, alpha 2 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007459.3-2380s21c1
Sequence:CCGGTTAGGCCGAATGTTCATATTTCTCGAGAAATATGAACATTCGGCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-2528s21c1
Sequence:CCGGTGCAACAAGTGGTCAACATTGCTCGAGCAATGTTGACCACTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-497s21c1
Sequence:CCGGGTGAACTGATCCGGTTGATTACTCGAGTAATCAACCGGATCAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238172    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-3658s21c1
Sequence:CCGGTCCTATCCCTATGGTACATTCCTCGAGGAATGTACCATAGGGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_007459.3-1608s21c1
Sequence:CCGGCTATGCTGCCAAGACGGTATTCTCGAGAATACCGTCTTGGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks