EMAIL THIS PAGE TO A FRIEND

AP2B1

adaptor-related protein complex 2, beta 1 subunit

Synonyms: ADTB2 AP105B AP2-BETA CLAPB1
UniProtKB ID: P63010, A6NJP3, P21851, Q96J19
Gene ID:
Human(163) Summary: The protein encoded by this gene is one of two large chain components of the assembly protein complex 2, which serves to link clathrin to receptors in coated vesicles. The encoded protein is found on the cytoplasmic face of coated vesicles in the plasma membrane. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71770) adaptor-related protein complex 2, beta 1 subunit
Rat(140670) adaptor-related protein complex 2, beta 1 subunit
sheep(101115974) adaptor-related protein complex 2, beta 1 subunit
Domestic Rabbit(100347007) adaptor-related protein complex 2, beta 1 subunit
domestic guinea pig(100713559) adaptor-related protein complex 2, beta 1 subunit
naked mole-rat(101709272) adaptor-related protein complex 2, beta 1 subunit
Zebrafish(334632) adaptor-related protein complex 2, beta 1 subunit
dog(480605) adaptor-related protein complex 2, beta 1 subunit
cow(282183) adaptor-related protein complex 2, beta 1 subunit
Horse(100058050) adaptor-related protein complex 2, beta 1 subunit
domestic cat(101084752) adaptor-related protein complex 2, beta 1 subunit
chicken(417525) adaptor-related protein complex 2, beta 1 subunit
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53576 Anti-AP2B1 (AB1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, bovine, zebrafish, human, rat, horse, mouse
western blot pricing
AV53577 Anti-AP2B1 (AB2) antibody produced in rabbit affinity isolated antibody rat, horse, guinea pig, canine, rabbit, bovine, human, mouse, zebrafish
western blot pricing
SAB2103463 Anti-AP2B1 antibody produced in rabbit affinity isolated antibody rat, canine, horse, zebrafish, human, rabbit, guinea pig, bovine, mouse
western blot pricing
HPA056733 Anti-AP2B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1402109 Monoclonal Anti-AP2B1 antibody produced in mouse clone 2D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
A4450 Monoclonal Anti-β1 and β2-Adaptins antibody produced in mouse clone 100/1, ascites fluid bovine, rat, human
immunofluorescence, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001282 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114571 MISSION® esiRNA esiRNA human AP2B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030006 Rosetta Predictions human pricing
NM_001282 Rosetta Predictions human pricing
NM_080583 Rosetta Predictions rat pricing
NM_001035854 Rosetta Predictions mouse pricing
NM_027915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307623 predicted 2455
2 SASI_Hs01_00161959 predicted 996
3 SASI_Hs01_00161960 predicted 1264
4 SASI_Hs01_00161961 predicted 2562
5 SASI_Hs02_00307624 predicted 1097
6 SASI_Hs01_00161964 predicted 2788
7 SASI_Hs02_00307625 predicted 2767
8 SASI_Hs01_00161965 predicted 718
9 SASI_Hs01_00161968 predicted 785
10 SASI_Hs02_00307626 predicted 625
11 SASI_Hs01_00161962 predicted 1379
12 SASI_Hs01_00161963 predicted 1364
13 SASI_Hs01_00161966 predicted 1954
14 SASI_Hs01_00161967 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331515 predicted 2412
2 SASI_Hs01_00044019 predicted 995
3 SASI_Hs01_00044020 predicted 1269
4 SASI_Hs01_00044021 predicted 2518
5 SASI_Hs02_00331516 predicted 1102
6 SASI_Hs01_00044024 predicted 2744
7 SASI_Hs02_00331517 predicted 2729
8 SASI_Hs01_00044025 predicted 713
9 SASI_Hs01_00044028 predicted 781
10 SASI_Hs02_00331518 predicted 628
11 SASI_Hs01_00044022 predicted 1385
12 SASI_Hs01_00044023 predicted 1358
13 SASI_Hs01_00044026 predicted 1963
14 SASI_Hs01_00044027 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046021 predicted 3051
2 SASI_Rn01_00046022 predicted 1293
3 SASI_Rn02_00267255 predicted 1856
4 SASI_Rn02_00267256 predicted 1857
5 SASI_Rn02_00267257 predicted 938
6 SASI_Rn01_00046015 predicted 2359
7 SASI_Rn01_00046016 predicted 2851
8 SASI_Rn01_00046017 predicted 2950
9 SASI_Rn01_00046018 predicted 2738
10 SASI_Rn01_00046019 predicted 820
11 SASI_Rn01_00046014 predicted 1212
12 SASI_Rn01_00046020 predicted 668
13 SASI_Rn01_00046023 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289268 predicted 1238
2 SASI_Mm01_00096437 predicted 1317
3 SASI_Mm02_00289269 predicted 2873
4 SASI_Mm02_00289270 predicted 2970
5 SASI_Mm02_00289271 predicted 1926
6 SASI_Mm01_00096439 predicted 686
7 SASI_Mm01_00096440 predicted 1859
8 SASI_Mm01_00096441 predicted 738
9 SASI_Mm02_00289272 predicted 2757
10 SASI_Mm01_00096446 predicted 3079
11 SASI_Mm01_00096438 predicted 2430
12 SASI_Mm01_00096442 predicted 2416
13 SASI_Mm01_00096443 predicted 1927
14 SASI_Mm01_00096444 predicted 1535
15 SASI_Mm01_00096445 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332887 predicted 1236
2 SASI_Mm01_00117297 predicted 1314
3 SASI_Mm02_00332888 predicted 2838
4 SASI_Mm02_00332889 predicted 2928
5 SASI_Mm02_00332890 predicted 1929
6 SASI_Mm01_00117299 predicted 690
7 SASI_Mm01_00117300 predicted 1857
8 SASI_Mm01_00117301 predicted 737
9 SASI_Mm02_00332891 predicted 2717
10 SASI_Mm01_00117306 predicted 3034
11 SASI_Mm01_00117298 predicted 2388
12 SASI_Mm01_00117302 predicted 2381
13 SASI_Mm01_00117303 predicted 1926
14 SASI_Mm01_00117304 predicted 1536
15 SASI_Mm01_00117305 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027915
VALIDATED
AP2B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, beta 1 subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-1526s21c1
Sequence:CCGGATATGCTGAAAGAATCGATAACTCGAGTTATCGATTCTTTCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-2424s21c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-2356s21c1
Sequence:CCGGACCGCCAAGGGCATATCTATACTCGAGTATAGATATGCCCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-926s21c1
Sequence:CCGGAGTGGTGCTTTCAGCCGTAAACTCGAGTTTACGGCTGAAAGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-1932s21c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-3093s21c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-3017s1c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-2348s1c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1424s1c1
Sequence:CCGGGCAGCTATGATTTGGATTGTACTCGAGTACAATCCAAATCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1352s1c1
Sequence:CCGGCCCAACAAGTATGAAAGTATTCTCGAGAATACTTTCATACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1856s1c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027915
VALIDATED
AP2B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, beta 1 subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-1526s21c1
Sequence:CCGGATATGCTGAAAGAATCGATAACTCGAGTTATCGATTCTTTCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-2424s21c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-2356s21c1
Sequence:CCGGACCGCCAAGGGCATATCTATACTCGAGTATAGATATGCCCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-926s21c1
Sequence:CCGGAGTGGTGCTTTCAGCCGTAAACTCGAGTTTACGGCTGAAAGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-1932s21c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-3093s21c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-3017s1c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-2348s1c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1424s1c1
Sequence:CCGGGCAGCTATGATTTGGATTGTACTCGAGTACAATCCAAATCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1352s1c1
Sequence:CCGGCCCAACAAGTATGAAAGTATTCTCGAGAATACTTTCATACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1856s1c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027915
VALIDATED
AP2B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, beta 1 subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-1526s21c1
Sequence:CCGGATATGCTGAAAGAATCGATAACTCGAGTTATCGATTCTTTCAGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027915.3-2424s21c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-2356s21c1
Sequence:CCGGACCGCCAAGGGCATATCTATACTCGAGTATAGATATGCCCTTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-926s21c1
Sequence:CCGGAGTGGTGCTTTCAGCCGTAAACTCGAGTTTACGGCTGAAAGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-1932s21c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027915.3-3093s21c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100495    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-3017s1c1
Sequence:CCGGCCAGTCATCTTGTGCTGACATCTCGAGATGTCAGCACAAGATGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-2348s1c1
Sequence:CCGGGCCATCCAGTTTAACAAGAATCTCGAGATTCTTGTTAAACTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1424s1c1
Sequence:CCGGGCAGCTATGATTTGGATTGTACTCGAGTACAATCCAAATCATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1352s1c1
Sequence:CCGGCCCAACAAGTATGAAAGTATTCTCGAGAATACTTTCATACTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027915.1-1856s1c1
Sequence:CCGGCGCAAACACTTGCCAATTCATCTCGAGATGAATTGGCAAGTGTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001282
AP2B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, beta 1 subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001282.2-951s21c1
Sequence:GTACCGGAGTGGTGCTTTCAGCGGTAAACTCGAGTTTACCGCTGAAAGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4508s1c1
Sequence:CCGGCCAGCCTGTTTAGCAGTGTTACTCGAGTAACACTGCTAAACAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-2841s1c1
Sequence:CCGGCCAATCCCTGAAGCTCACTAACTCGAGTTAGTGAGCTTCAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1477s1c1
Sequence:CCGGGAGAACTTAGACTCGCTGGATCTCGAGATCCAGCGAGTCTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1362s1c1
Sequence:CCGGGCTTGATCTAATCCAGACCAACTCGAGTTGGTCTGGATTAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1942s1c1
Sequence:CCGGCATCGTAAACACTTGCCAATTCTCGAGAATTGGCAAGTGTTTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-279s1c1
Sequence:CCGGGAAGAAAGTGATTGCTGCTATCTCGAGATAGCAGCAATCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-378s1c1
Sequence:CCGGGCTTGTGTATCTCTACTTGATCTCGAGATCAAGTAGAGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-1705s1c1
Sequence:CCGGGCAACACAGGATTCTGATAATCTCGAGATTATCAGAATCCTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4455s1c1
Sequence:CCGGCCCACTTAATGCGTTGGATATCTCGAGATATCCAACGCATTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001282
AP2B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, beta 1 subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001282.2-951s21c1
Sequence:GTACCGGAGTGGTGCTTTCAGCGGTAAACTCGAGTTTACCGCTGAAAGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4508s1c1
Sequence:CCGGCCAGCCTGTTTAGCAGTGTTACTCGAGTAACACTGCTAAACAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-2841s1c1
Sequence:CCGGCCAATCCCTGAAGCTCACTAACTCGAGTTAGTGAGCTTCAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1477s1c1
Sequence:CCGGGAGAACTTAGACTCGCTGGATCTCGAGATCCAGCGAGTCTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1362s1c1
Sequence:CCGGGCTTGATCTAATCCAGACCAACTCGAGTTGGTCTGGATTAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1942s1c1
Sequence:CCGGCATCGTAAACACTTGCCAATTCTCGAGAATTGGCAAGTGTTTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-279s1c1
Sequence:CCGGGAAGAAAGTGATTGCTGCTATCTCGAGATAGCAGCAATCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-378s1c1
Sequence:CCGGGCTTGTGTATCTCTACTTGATCTCGAGATCAAGTAGAGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-1705s1c1
Sequence:CCGGGCAACACAGGATTCTGATAATCTCGAGATTATCAGAATCCTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4455s1c1
Sequence:CCGGCCCACTTAATGCGTTGGATATCTCGAGATATCCAACGCATTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001282
AP2B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, beta 1 subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001282.2-951s21c1
Sequence:GTACCGGAGTGGTGCTTTCAGCGGTAAACTCGAGTTTACCGCTGAAAGCACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4508s1c1
Sequence:CCGGCCAGCCTGTTTAGCAGTGTTACTCGAGTAACACTGCTAAACAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-2841s1c1
Sequence:CCGGCCAATCCCTGAAGCTCACTAACTCGAGTTAGTGAGCTTCAGGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1477s1c1
Sequence:CCGGGAGAACTTAGACTCGCTGGATCTCGAGATCCAGCGAGTCTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1362s1c1
Sequence:CCGGGCTTGATCTAATCCAGACCAACTCGAGTTGGTCTGGATTAGATCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001282.1-1942s1c1
Sequence:CCGGCATCGTAAACACTTGCCAATTCTCGAGAATTGGCAAGTGTTTACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-279s1c1
Sequence:CCGGGAAGAAAGTGATTGCTGCTATCTCGAGATAGCAGCAATCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-378s1c1
Sequence:CCGGGCTTGTGTATCTCTACTTGATCTCGAGATCAAGTAGAGATACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001282.1-1705s1c1
Sequence:CCGGGCAACACAGGATTCTGATAATCTCGAGATTATCAGAATCCTGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001282.1-4455s1c1
Sequence:CCGGCCCACTTAATGCGTTGGATATCTCGAGATATCCAACGCATTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks