EMAIL THIS PAGE TO A FRIEND

AP2M1

adaptor-related protein complex 2, mu 1 subunit

109 Gene Product Result for
Synonyms: AP50 CLAPM1 mu2
UniProtKB ID: Q96CW1, A6NE12, D3DNT1, P20172, P53679
Gene ID:
Human(1173) Summary: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11773) adaptor-related protein complex 2, mu 1 subunit
Rat(116563) adaptor-related protein complex 2, mu 1 subunit
chicken(770246) adaptor-related protein complex 2, mu 1 subunit
cow(517446) adaptor-related protein complex 2, mu 1 subunit
Horse(100058961) adaptor-related protein complex 2, mu 1 subunit
domestic cat(101088686) adaptor-related protein complex 2, mu 1 subunit
dog(607139) adaptor-related protein complex 2, mu 1 subunit
naked mole-rat(101716647) adaptor-related protein complex 2, mu 1 subunit
domestic guinea pig(100724046) adaptor-related protein complex 2, mu 1 subunit
sheep(101122320) adaptor-related protein complex 2, mu 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025205 Rosetta Predictions human pricing
NM_004068 Rosetta Predictions human pricing
NM_053837 Rosetta Predictions rat pricing
NM_009679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307415 predicted 217
2 SASI_Hs01_00183181 predicted 319
3 SASI_Hs02_00307416 predicted 941
4 SASI_Hs01_00183183 predicted 1581
5 SASI_Hs01_00183185 predicted 967
6 SASI_Hs01_00183186 predicted 955
7 SASI_Hs02_00307417 predicted 968
8 SASI_Hs01_00183187 predicted 859
9 SASI_Hs02_00307418 predicted 326
10 SASI_Hs02_00307419 predicted 840
11 SASI_Hs01_00183180 predicted 796
12 SASI_Hs01_00183182 predicted 1404
13 SASI_Hs01_00183184 predicted 791
14 SASI_Hs01_00183188 predicted 1195
15 SASI_Hs01_00183189 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336858 predicted 218
2 SASI_Hs01_00058059 predicted 795
3 SASI_Hs01_00058060 predicted 324
4 SASI_Hs02_00336859 predicted 947
5 SASI_Hs01_00058062 predicted 1589
6 SASI_Hs01_00058063 predicted 785
7 SASI_Hs01_00058064 predicted 965
8 SASI_Hs01_00058065 predicted 961
9 SASI_Hs02_00336860 predicted 970
10 SASI_Hs01_00058066 predicted 864
11 SASI_Hs01_00058061 predicted 1408
12 SASI_Hs01_00058067 predicted 1195
13 SASI_Hs01_00058068 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075310 predicted 315
2 SASI_Rn01_00075311 predicted 551
3 SASI_Rn01_00075312 predicted 873
4 SASI_Rn02_00266684 predicted 1272
5 SASI_Rn01_00075313 predicted 881
6 SASI_Rn01_00075314 predicted 567
7 SASI_Rn01_00075315 predicted 1305
8 SASI_Rn01_00075316 predicted 554
9 SASI_Rn01_00075318 predicted 696
10 SASI_Rn01_00075319 predicted 702
11 SASI_Rn01_00075317 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316744 predicted 395
2 SASI_Mm02_00316745 predicted 645
3 SASI_Mm01_00200390 predicted 949
4 SASI_Mm01_00200391 predicted 1392
5 SASI_Mm02_00316746 predicted 1050
6 SASI_Mm02_00316747 predicted 775
7 SASI_Mm01_00200395 predicted 300
8 SASI_Mm01_00200396 predicted 1369
9 SASI_Mm01_00200397 predicted 1338
10 SASI_Mm01_00200398 predicted 356
11 SASI_Mm01_00200392 predicted 778
12 SASI_Mm01_00200393 predicted 633
13 SASI_Mm01_00200394 predicted 383
14 SASI_Mm01_00200399 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009679
VALIDATED
AP2M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, mu 1 subunit
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009679.1-1828s1c1
Sequence:CCGGCCACTCTGCTTTGGGATAGTACTCGAGTACTATCCCAAAGCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-1261s1c1
Sequence:CCGGCCCACCAACGATAAGAAGAAACTCGAGTTTCTTCTTATCGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-945s1c1
Sequence:CCGGCGACGGAGAGTTTGAACTCATCTCGAGATGAGTTCAAACTCTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-768s1c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-972s1c1
Sequence:CCGGCCGTACTACCAAGGACATCATCTCGAGATGATGTCCTTGGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-768s21c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1879s21c1
Sequence:CCGGTCCAGTTACAAACCCAATAAACTCGAGTTTATTGGGTTTGTAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1382s21c1
Sequence:CCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1414s21c1
Sequence:CCGGATTGGCCGCAGTGGCATTTATCTCGAGATAAATGCCACTGCGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1753s21c1
Sequence:GTACCGGTGCAGTGGGAAGGTTGACTACCTCGAGGTAGTCAACCTTCCCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1830s21c1
Sequence:GTACCGGACTCTGCTTTGGGATAGTATGCTCGAGCATACTATCCCAAAGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-819s21c1
Sequence:GTACCGGCAAAGGCACAGCTGATGAAACCTCGAGGTTTCATCAGCTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009679
VALIDATED
AP2M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, mu 1 subunit
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009679.1-1828s1c1
Sequence:CCGGCCACTCTGCTTTGGGATAGTACTCGAGTACTATCCCAAAGCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-1261s1c1
Sequence:CCGGCCCACCAACGATAAGAAGAAACTCGAGTTTCTTCTTATCGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-945s1c1
Sequence:CCGGCGACGGAGAGTTTGAACTCATCTCGAGATGAGTTCAAACTCTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-768s1c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-972s1c1
Sequence:CCGGCCGTACTACCAAGGACATCATCTCGAGATGATGTCCTTGGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-768s21c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1879s21c1
Sequence:CCGGTCCAGTTACAAACCCAATAAACTCGAGTTTATTGGGTTTGTAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1382s21c1
Sequence:CCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1414s21c1
Sequence:CCGGATTGGCCGCAGTGGCATTTATCTCGAGATAAATGCCACTGCGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1753s21c1
Sequence:GTACCGGTGCAGTGGGAAGGTTGACTACCTCGAGGTAGTCAACCTTCCCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1830s21c1
Sequence:GTACCGGACTCTGCTTTGGGATAGTATGCTCGAGCATACTATCCCAAAGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-819s21c1
Sequence:GTACCGGCAAAGGCACAGCTGATGAAACCTCGAGGTTTCATCAGCTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009679
VALIDATED
AP2M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, mu 1 subunit
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009679.1-1828s1c1
Sequence:CCGGCCACTCTGCTTTGGGATAGTACTCGAGTACTATCCCAAAGCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-1261s1c1
Sequence:CCGGCCCACCAACGATAAGAAGAAACTCGAGTTTCTTCTTATCGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009679.1-945s1c1
Sequence:CCGGCGACGGAGAGTTTGAACTCATCTCGAGATGAGTTCAAACTCTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-768s1c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009679.1-972s1c1
Sequence:CCGGCCGTACTACCAAGGACATCATCTCGAGATGATGTCCTTGGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-768s21c1
Sequence:CCGGGCCTGAGTGCAAGTTTGGAATCTCGAGATTCCAAACTTGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1879s21c1
Sequence:CCGGTCCAGTTACAAACCCAATAAACTCGAGTTTATTGGGTTTGTAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1382s21c1
Sequence:CCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1414s21c1
Sequence:CCGGATTGGCCGCAGTGGCATTTATCTCGAGATAAATGCCACTGCGGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1753s21c1
Sequence:GTACCGGTGCAGTGGGAAGGTTGACTACCTCGAGGTAGTCAACCTTCCCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-1830s21c1
Sequence:GTACCGGACTCTGCTTTGGGATAGTATGCTCGAGCATACTATCCCAAAGCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009679.2-819s21c1
Sequence:GTACCGGCAAAGGCACAGCTGATGAAACCTCGAGGTTTCATCAGCTGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004068
VALIDATED
AP2M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, mu 1 subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1422s1c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-468s1c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1048s1c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-291s1c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-642s21c1
Sequence:GTACCGGGGCGAGAGGGTATCAAGTATCCTCGAGGATACTTGATACCCTCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1070s21c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-490s21c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-313s21c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1444s21c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1690s21c1
Sequence:GTACCGGACCTGTCTGTCCTGGCCTAATCTCGAGATTAGGCCAGGACAGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1398s21c1
Sequence:GTACCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004068
VALIDATED
AP2M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, mu 1 subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1422s1c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-468s1c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1048s1c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-291s1c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-642s21c1
Sequence:GTACCGGGGCGAGAGGGTATCAAGTATCCTCGAGGATACTTGATACCCTCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1070s21c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-490s21c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-313s21c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1444s21c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1690s21c1
Sequence:GTACCGGACCTGTCTGTCCTGGCCTAATCTCGAGATTAGGCCAGGACAGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1398s21c1
Sequence:GTACCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004068
VALIDATED
AP2M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, mu 1 subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1422s1c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-468s1c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-1048s1c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004068.2-291s1c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-642s21c1
Sequence:GTACCGGGGCGAGAGGGTATCAAGTATCCTCGAGGATACTTGATACCCTCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1070s21c1
Sequence:CCGGGTGGTCATCAAGTCCAACTTTCTCGAGAAAGTTGGACTTGATGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-490s21c1
Sequence:CCGGGCTGGATGAGATTCTAGACTTCTCGAGAAGTCTAGAATCTCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-313s21c1
Sequence:CCGGCACCAGCTTCTTCCACGTTAACTCGAGTTAACGTGGAAGAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1444s21c1
Sequence:CCGGCATTTATGAAACTCGCTGCTACTCGAGTAGCAGCGAGTTTCATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004068.3-1690s21c1
Sequence:GTACCGGACCTGTCTGTCCTGGCCTAATCTCGAGATTAGGCCAGGACAGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004068.3-1398s21c1
Sequence:GTACCGGGCGACCATGATGTCATCAAATCTCGAGATTTGATGACATCATGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks