EMAIL THIS PAGE TO A FRIEND

AP2S1

adaptor-related protein complex 2, sigma 1 subunit

94 Gene Product Result for
Synonyms: AP17 AP17-DELTA CLAPS2 HHC3
UniProtKB ID: P53680, B2R4Z4, O75977, Q6PK67
Gene ID:
Human(1175) Summary: One of two major clathrin-associated adaptor complexes, AP-2, is a heterotetramer which is associated with the plasma membrane. This complex is composed of two large chains, a medium chain, and a small chain. This gene encodes the small chain of this complex. Alternative splicing has been observed in this gene and results in two known transcripts. [provided by RefSeq, Jul 2008]
Mouse(232910) adaptor-related protein complex 2, sigma 1 subunit
Rat(65046) adaptor-related protein complex 2, sigma 1 subunit
naked mole-rat(101719710) adaptor-related protein complex 2, sigma 1 subunit
domestic guinea pig(100726815) adaptor-related protein complex 2, sigma 1 subunit
sheep(101122460) adaptor-related protein complex 2, sigma 1 subunit
Zebrafish(100148085) adaptor-related protein complex 2, sigma 1 subunit
cow(536553) adaptor-related protein complex 2, sigma 1 subunit
domestic cat(101090159) adaptor-related protein complex 2, sigma 1 subunit
dog(476427) adaptor-related protein complex 2, sigma 1 subunit
chicken(431511) adaptor-related protein complex 2, sigma 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004069 Rosetta Predictions human pricing
NM_021575 Rosetta Predictions human pricing
NM_022952 Rosetta Predictions rat pricing
NM_198613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098102 predicted 354
2 SASI_Hs01_00098103 predicted 335
3 SASI_Hs02_00336861 predicted 235
4 SASI_Hs01_00098104 predicted 411
5 SASI_Hs01_00098105 predicted 378
6 SASI_Hs01_00098107 predicted 321
7 SASI_Hs01_00098108 predicted 306
8 SASI_Hs02_00336862 predicted 377
9 SASI_Hs01_00098109 predicted 229
10 SASI_Hs01_00098110 predicted 230
11 SASI_Hs01_00098106 predicted 490
12 SASI_Hs01_00098111 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193198 predicted 233
2 SASI_Hs01_00193201 predicted 229
3 SASI_Hs01_00193202 predicted 228
4 SASI_Hs01_00193203 predicted 309
5 SASI_Hs01_00193204 predicted 443
6 SASI_Hs01_00193205 predicted 299
7 SASI_Hs02_00354936 predicted 320
8 SASI_Hs02_00354937 predicted 447
9 SASI_Hs02_00354938 predicted 223
10 SASI_Hs02_00354939 predicted 431
11 SASI_Hs01_00193199 predicted 368
12 SASI_Hs01_00193200 predicted 335
13 SASI_Hs01_00193206 predicted 329
14 SASI_Hs01_00193207 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263685 predicted 323
2 SASI_Rn01_00068297 predicted 305
3 SASI_Rn01_00068299 predicted 434
4 SASI_Rn01_00068300 predicted 317
5 SASI_Rn01_00068301 predicted 270
6 SASI_Rn01_00068302 predicted 268
7 SASI_Rn01_00068303 predicted 314
8 SASI_Rn01_00068304 predicted 292
9 SASI_Rn01_00068305 predicted 286
10 SASI_Rn01_00068306 predicted 221
11 SASI_Rn01_00068298 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028950 predicted 292
2 SASI_Mm01_00028952 predicted 338
3 SASI_Mm02_00351033 predicted 226
4 SASI_Mm01_00028953 predicted 462
5 SASI_Mm01_00028954 predicted 345
6 SASI_Mm01_00028956 predicted 339
7 SASI_Mm02_00351034 predicted 232
8 SASI_Mm01_00028957 predicted 419
9 SASI_Mm01_00028958 predicted 409
10 SASI_Mm02_00351035 predicted 318
11 SASI_Mm01_00028951 predicted 227
12 SASI_Mm01_00028955 predicted 319
13 SASI_Mm01_00028959 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004069
VALIDATED
AP2S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, sigma 1 subunit
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-269s21c1
Sequence:CCGGAGCTGATCGAGGAGGTGCATGCTCGAGCATGCACCTCCTCGATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-433s21c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-229s21c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-492s21c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-307s21c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-564s21c1
Sequence:CCGGGACGAAGGTGCTGAAACAGCTCTCGAGAGCTGTTTCAGCACCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-383s21c1
Sequence:CCGGGCATCTGTGTGGATGTCAATGCTCGAGCATTGACATCCACACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-442s21c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-119s1c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-197s1c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-323s1c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-332s1c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-382s1c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004069
VALIDATED
AP2S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, sigma 1 subunit
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-269s21c1
Sequence:CCGGAGCTGATCGAGGAGGTGCATGCTCGAGCATGCACCTCCTCGATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-433s21c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-229s21c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-492s21c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-307s21c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-564s21c1
Sequence:CCGGGACGAAGGTGCTGAAACAGCTCTCGAGAGCTGTTTCAGCACCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-383s21c1
Sequence:CCGGGCATCTGTGTGGATGTCAATGCTCGAGCATTGACATCCACACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-442s21c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-119s1c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-197s1c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-323s1c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-332s1c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-382s1c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004069
VALIDATED
AP2S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, sigma 1 subunit
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-269s21c1
Sequence:CCGGAGCTGATCGAGGAGGTGCATGCTCGAGCATGCACCTCCTCGATCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-433s21c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-229s21c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-492s21c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-307s21c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-564s21c1
Sequence:CCGGGACGAAGGTGCTGAAACAGCTCTCGAGAGCTGTTTCAGCACCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-383s21c1
Sequence:CCGGGCATCTGTGTGGATGTCAATGCTCGAGCATTGACATCCACACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004069.3-442s21c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-119s1c1
Sequence:CCGGGCCAAGTGGTACATGCAGTTTCTCGAGAAACTGCATGTACCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-197s1c1
Sequence:CCGGGACGCCAAACACACCAACTTTCTCGAGAAAGTTGGTGTGTTTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004069.2-323s1c1
Sequence:CCGGCACAACTTCGTGGAGGTCTTACTCGAGTAAGACCTCCACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-332s1c1
Sequence:CCGGGTGGAGGTCTTAAACGAATATCTCGAGATATTCGTTTAAGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004069.2-382s1c1
Sequence:CCGGGTTCAACTTCTACAAGGTTTACTCGAGTAAACCTTGTAGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198613
AP2S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 2, sigma 1 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-398s21c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-219s21c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198613.2-710s21c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-339s21c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198613.1-671s1c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-180s1c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-306s1c1
Sequence:CCGGCACAACTTCGTAGAAGTGTTACTCGAGTAACACTTCTACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-300s1c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-359s1c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198613
AP2S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 2, sigma 1 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-398s21c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-219s21c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198613.2-710s21c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-339s21c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198613.1-671s1c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-180s1c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-306s1c1
Sequence:CCGGCACAACTTCGTAGAAGTGTTACTCGAGTAACACTTCTACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-300s1c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-359s1c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198613
AP2S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 2, sigma 1 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-398s21c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-219s21c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198613.2-710s21c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198613.2-339s21c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198613.1-671s1c1
Sequence:CCGGCCACCGTGATGTCCCGAGTAACTCGAGTTACTCGGGACATCACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-180s1c1
Sequence:CCGGGATGCCAAGCACACCAACTTTCTCGAGAAAGTTGGTGTGCTTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-306s1c1
Sequence:CCGGCACAACTTCGTAGAAGTGTTACTCGAGTAACACTTCTACGAAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-300s1c1
Sequence:CCGGGCCATCCACAACTTCGTAGAACTCGAGTTCTACGAAGTTGTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198613.1-359s1c1
Sequence:CCGGCCTGGTGTTCAACTTCTACAACTCGAGTTGTAGAAGTTGAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks